ID: 901833957

View in Genome Browser
Species Human (GRCh38)
Location 1:11911659-11911681
Sequence AGTGACTTGCTAAAGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901833957_901833960 -10 Left 901833957 1:11911659-11911681 CCTTTGACCTTTAGCAAGTCACT No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833957_901833962 17 Left 901833957 1:11911659-11911681 CCTTTGACCTTTAGCAAGTCACT No data
Right 901833962 1:11911699-11911721 AATTTGCACTTTGTAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901833957 Original CRISPR AGTGACTTGCTAAAGGTCAA AGG (reversed) Intergenic
No off target data available for this crispr