ID: 901833960

View in Genome Browser
Species Human (GRCh38)
Location 1:11911672-11911694
Sequence GCAAGTCACTGTTTTTCACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901833953_901833960 10 Left 901833953 1:11911639-11911661 CCACCCAACTCCATGAGTGACCT No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833957_901833960 -10 Left 901833957 1:11911659-11911681 CCTTTGACCTTTAGCAAGTCACT No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833952_901833960 13 Left 901833952 1:11911636-11911658 CCACCACCCAACTCCATGAGTGA No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833951_901833960 25 Left 901833951 1:11911624-11911646 CCTGCAAGGGTGCCACCACCCAA No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833954_901833960 7 Left 901833954 1:11911642-11911664 CCCAACTCCATGAGTGACCTTTG No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833956_901833960 0 Left 901833956 1:11911649-11911671 CCATGAGTGACCTTTGACCTTTA No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data
901833955_901833960 6 Left 901833955 1:11911643-11911665 CCAACTCCATGAGTGACCTTTGA No data
Right 901833960 1:11911672-11911694 GCAAGTCACTGTTTTTCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901833960 Original CRISPR GCAAGTCACTGTTTTTCACC GGG Intergenic
No off target data available for this crispr