ID: 901833962

View in Genome Browser
Species Human (GRCh38)
Location 1:11911699-11911721
Sequence AATTTGCACTTTGTAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901833957_901833962 17 Left 901833957 1:11911659-11911681 CCTTTGACCTTTAGCAAGTCACT No data
Right 901833962 1:11911699-11911721 AATTTGCACTTTGTAAAACATGG No data
901833958_901833962 10 Left 901833958 1:11911666-11911688 CCTTTAGCAAGTCACTGTTTTTC No data
Right 901833962 1:11911699-11911721 AATTTGCACTTTGTAAAACATGG No data
901833956_901833962 27 Left 901833956 1:11911649-11911671 CCATGAGTGACCTTTGACCTTTA No data
Right 901833962 1:11911699-11911721 AATTTGCACTTTGTAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901833962 Original CRISPR AATTTGCACTTTGTAAAACA TGG Intergenic
No off target data available for this crispr