ID: 901834343

View in Genome Browser
Species Human (GRCh38)
Location 1:11914169-11914191
Sequence AAGGGTAGCCAGTCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901834340_901834343 -7 Left 901834340 1:11914153-11914175 CCATTTTTGTTACCATAAGGGTA No data
Right 901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901834343 Original CRISPR AAGGGTAGCCAGTCTGAGGA TGG Intergenic
No off target data available for this crispr