ID: 901836081

View in Genome Browser
Species Human (GRCh38)
Location 1:11925253-11925275
Sequence GCTCTTGGACATGCCAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901836081_901836089 26 Left 901836081 1:11925253-11925275 CCGCCGCTGGCATGTCCAAGAGC 0: 1
1: 2
2: 1
3: 6
4: 54
Right 901836089 1:11925302-11925324 CTGCAGCGCCTTGAGCTCCTTGG 0: 2
1: 0
2: 3
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901836081 Original CRISPR GCTCTTGGACATGCCAGCGG CGG (reversed) Exonic
900409068 1:2504708-2504730 GCTCTTGGACTTGGCAGCCACGG - Exonic
901836081 1:11925253-11925275 GCTCTTGGACATGCCAGCGGCGG - Exonic
902157491 1:14500247-14500269 GCTCTTTGACATGCCAGCGTAGG - Intergenic
903070329 1:20724007-20724029 GCTCCTGGACCAGCCAGAGGTGG - Intronic
915915999 1:159941413-159941435 GCTCTTGGTCAGGCCAGAGCCGG - Intronic
1062892422 10:1074244-1074266 ACTCTAGAACATGCCAGCAGGGG - Intronic
1069022156 10:63501124-63501146 GCTCTTGAACCTGCCAGACGCGG + Intergenic
1075808069 10:125204492-125204514 GCTCCTGGAGATGCCAGGGTGGG + Intergenic
1081224957 11:40509917-40509939 GCTCTTGTCCATGGCAGCGGAGG + Intronic
1082915365 11:58428439-58428461 GCACTTGTACATGCCATCGTGGG + Intergenic
1083476744 11:62920347-62920369 GCTCCTGGGCAGGCCAGCTGGGG - Intronic
1084814672 11:71639268-71639290 GCTCTTGGCCAGGCCAGCTCCGG - Intergenic
1089629933 11:119778221-119778243 GCTCTTCCACATGCCAGCCTTGG + Intergenic
1117941588 14:60972455-60972477 TCTCTTGGGCATGGCGGCGGCGG + Exonic
1118696772 14:68393704-68393726 GCTCTTTGACATGGCAATGGAGG + Intronic
1124955968 15:34360487-34360509 AGTCTCTGACATGCCAGCGGAGG + Intronic
1126213854 15:46132050-46132072 GCGCTTGCACATGCCAGCAGTGG + Intergenic
1128431591 15:67600715-67600737 ACTCTTGGTCATGGCAACGGAGG + Exonic
1131146554 15:90017577-90017599 GATGTTGGACATGCCAGCTCAGG - Intronic
1134531713 16:14989176-14989198 GCTCTTGGAGATGCCAGCGGCGG - Intronic
1136452205 16:30359726-30359748 GCTCATGCACATGCCTGCGGAGG - Exonic
1141043286 16:80690764-80690786 GCTCTAGGAGAGGCCAGCGCAGG - Intronic
1141984529 16:87571209-87571231 GCCCTTGGGCCTCCCAGCGGTGG + Intergenic
1142057767 16:88010436-88010458 GCTCTTGGTGATGCCAGTGAAGG + Intronic
1152059950 17:78064877-78064899 GCTCTTCCAAATGCCACCGGCGG - Exonic
1152451223 17:80381684-80381706 GCTCTTGGAGAAGCCTGCGCAGG - Exonic
1153993178 18:10417942-10417964 GCTCTTTGAGATGCAAGAGGTGG - Intergenic
1156888153 18:42159324-42159346 ACTCTTGGACATGACAGGGGAGG + Intergenic
1163072771 19:14858316-14858338 TCTCTTGAACATGGCAGTGGAGG + Intergenic
1166685081 19:44791771-44791793 GCCATTGGACATGCCAGCCTTGG + Intronic
930154303 2:48090259-48090281 GTTCTTGGACATGGCAGAGCTGG + Intergenic
933697604 2:85231580-85231602 GATCTTGGATACACCAGCGGTGG - Intronic
945049380 2:205808661-205808683 GCTGTTGGACATGCCAGGTCTGG + Intergenic
1169070950 20:2730053-2730075 GCACCTGGAAATGCCAGGGGTGG - Intronic
1174709112 20:52686407-52686429 GTTCCTGGACATCCCAGGGGAGG + Intergenic
1184739735 22:46420958-46420980 GCTCTGGGACGTGCCATCCGAGG - Intronic
955297023 3:57745368-57745390 GCTTTTGTACATGCAAGCAGAGG + Intergenic
956675488 3:71728487-71728509 GCTCTAGGAAATGACAGAGGCGG + Intronic
960996459 3:123343668-123343690 CCTCTGGGACATGCCAGCAGAGG - Intronic
963040458 3:141066221-141066243 GCTGTTGGACATGCCAGCGGCGG + Exonic
969480635 4:7445191-7445213 TCTCTGGGACATGCCTGCAGAGG + Intronic
978078959 4:104568414-104568436 CCTCTTGGACTTCCCAGCTGAGG + Intergenic
978405023 4:108370314-108370336 GCTTTTGAACAGGGCAGCGGGGG + Intergenic
984168968 4:176338315-176338337 GTTCTTGGATATGCCAAGGGAGG + Intergenic
995572099 5:113491300-113491322 CTTTTTGGACATGCCAGCTGTGG + Intergenic
1003621397 6:7704335-7704357 GCTCTTGGACCTGACAACGGGGG + Intergenic
1012164989 6:95937891-95937913 GCTCTTGGAAATGCGCGCAGAGG - Intergenic
1018027638 6:159818374-159818396 GCTTTTAGACTTGCCAGCTGGGG + Intronic
1018028191 6:159821895-159821917 GCTGTTTGGCATCCCAGCGGTGG + Intergenic
1019552674 7:1610872-1610894 GCTGCTGGAGATGCCAGCGCGGG - Intergenic
1023876814 7:44290686-44290708 GCTCTTGGGAGTGCCAGAGGGGG + Intronic
1027268200 7:76505361-76505383 GCTCTAGGACCTGCCCGGGGAGG - Exonic
1034432274 7:151047029-151047051 GCTTGTGGACTTGCCAGCTGAGG - Intronic
1035307040 7:157940069-157940091 GCTCATGGTCATACCAACGGGGG - Intronic
1035396332 7:158537436-158537458 GCCCAAGGACAGGCCAGCGGGGG + Intronic
1035595887 8:857636-857658 GATCTTGGCCATTCCAGCAGGGG - Intergenic
1035838284 8:2782092-2782114 GCTGGGTGACATGCCAGCGGTGG + Intergenic
1037855083 8:22366255-22366277 GCTCTTCGCCAGGCCAGAGGGGG - Intergenic
1042164213 8:65930075-65930097 GCTCTTGGAGTAGCCAGCAGGGG + Intergenic
1057032151 9:91784068-91784090 TCTCCTGGACATGCAAGTGGAGG - Intronic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1058826044 9:108776873-108776895 GCTCTTGGCCATGACAGGGTGGG + Intergenic
1060577422 9:124709428-124709450 GCTATGTGACATGCCAGGGGAGG + Intronic
1193031973 X:76908083-76908105 GCACTTGGCCATGCCAGCCATGG - Intergenic