ID: 901836257

View in Genome Browser
Species Human (GRCh38)
Location 1:11925982-11926004
Sequence GCGCGGTGAGGTGGTACCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901836257_901836271 20 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836271 1:11926025-11926047 GCGGGTGGCCGCCTCCAGGCAGG 0: 2
1: 0
2: 1
3: 16
4: 246
901836257_901836267 5 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836267 1:11926010-11926032 CAGGCCGCGCCAGGCGCGGGTGG 0: 2
1: 0
2: 1
3: 18
4: 245
901836257_901836270 16 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836270 1:11926021-11926043 AGGCGCGGGTGGCCGCCTCCAGG 0: 2
1: 0
2: 0
3: 13
4: 141
901836257_901836262 -4 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836262 1:11926001-11926023 GCGCTCCCGCAGGCCGCGCCAGG 0: 2
1: 0
2: 3
3: 26
4: 192
901836257_901836266 2 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836266 1:11926007-11926029 CCGCAGGCCGCGCCAGGCGCGGG 0: 2
1: 0
2: 2
3: 23
4: 279
901836257_901836264 1 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836264 1:11926006-11926028 CCCGCAGGCCGCGCCAGGCGCGG 0: 2
1: 0
2: 0
3: 27
4: 237
901836257_901836272 27 Left 901836257 1:11925982-11926004 CCAGCGGTACCACCTCACCGCGC 0: 1
1: 0
2: 1
3: 6
4: 36
Right 901836272 1:11926032-11926054 GCCGCCTCCAGGCAGGCAGACGG 0: 2
1: 0
2: 2
3: 36
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901836257 Original CRISPR GCGCGGTGAGGTGGTACCGC TGG (reversed) Exonic