ID: 901836393

View in Genome Browser
Species Human (GRCh38)
Location 1:11926452-11926474
Sequence CTTTTACGACAGATGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901836389_901836393 13 Left 901836389 1:11926416-11926438 CCGTCAAACGACGCCGGCGGTCA 0: 1
1: 0
2: 0
3: 0
4: 2
Right 901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG 0: 1
1: 0
2: 0
3: 11
4: 169
901836387_901836393 17 Left 901836387 1:11926412-11926434 CCAGCCGTCAAACGACGCCGGCG 0: 1
1: 0
2: 0
3: 0
4: 5
Right 901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG 0: 1
1: 0
2: 0
3: 11
4: 169
901836385_901836393 20 Left 901836385 1:11926409-11926431 CCTCCAGCCGTCAAACGACGCCG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG 0: 1
1: 0
2: 0
3: 11
4: 169
901836390_901836393 0 Left 901836390 1:11926429-11926451 CCGGCGGTCAAGCGTCGCCGTGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG 0: 1
1: 0
2: 0
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901836393 Original CRISPR CTTTTACGACAGATGGAAAA CGG Intergenic
901612875 1:10512995-10513017 CTTTTATAAAAGAAGGAAAAGGG - Intronic
901836393 1:11926452-11926474 CTTTTACGACAGATGGAAAACGG + Intergenic
909872606 1:80761889-80761911 CCTTTACGATTGATGGCAAAAGG + Intergenic
910914932 1:92278513-92278535 AATTTAGGAGAGATGGAAAAAGG - Intronic
912621187 1:111160019-111160041 CTTTTACCACAGGAGAAAAAAGG + Intronic
912972182 1:114293883-114293905 CTTTTACCAGGGATGGTAAAAGG - Intergenic
916513761 1:165496666-165496688 CTTTGACAACAGCTGGAAAGTGG - Intergenic
916742301 1:167656823-167656845 CCTTTAGAGCAGATGGAAAAGGG - Intronic
917089739 1:171341193-171341215 ATTTTACTAGAGATGGTAAAAGG - Intronic
921700307 1:218261900-218261922 TTATTACAACACATGGAAAATGG - Intergenic
921951793 1:220937705-220937727 CTCTTATGCCAGAGGGAAAAGGG - Intergenic
921951890 1:220938743-220938765 CTCTTATGTCAGAGGGAAAAGGG + Intergenic
922421666 1:225464671-225464693 CATTAACGTCACATGGAAAAGGG + Intergenic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1064704012 10:18051590-18051612 CTTTTTCTACAGCTTGAAAATGG - Intergenic
1064834198 10:19507005-19507027 CTATTATGACAGATGGTGAAGGG + Intronic
1065769773 10:29067060-29067082 CTTTAAAGACAAATGGCAAATGG + Intergenic
1066302927 10:34112774-34112796 ATTTTAGGCCATATGGAAAATGG - Intronic
1067931616 10:50567796-50567818 CTTTTTCCACAGGGGGAAAAGGG + Intronic
1070232775 10:74587793-74587815 ATTTTAGGACAGATAGAAAAGGG - Intronic
1070431742 10:76347089-76347111 CTTTTATTACAGATAGATAAAGG + Intronic
1074458657 10:113616919-113616941 CCTTTCCCACAGAGGGAAAAGGG + Intronic
1074692889 10:116022555-116022577 CTCTTATCACTGATGGAAAATGG - Intergenic
1074700252 10:116086291-116086313 CCTTTACAACAGATGGAAGGTGG - Intronic
1079880232 11:25918631-25918653 CTTTAAGGCCAGATGAAAAATGG + Intergenic
1080324479 11:31054215-31054237 CTTTTACAATAGCTGAAAAAAGG + Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1081782813 11:45724928-45724950 TTTTCATGACAGAAGGAAAAAGG + Intergenic
1090532536 11:127606007-127606029 CAGTTACGACAGAGGAAAAAAGG + Intergenic
1091337398 11:134782697-134782719 ATTTTAATACTGATGGAAAATGG - Intergenic
1092745885 12:11672153-11672175 ATTTTGCGACAGAAGGAACAGGG - Intronic
1094496766 12:30993752-30993774 CTCTTACGACAGAGGGAGAGTGG + Exonic
1095043213 12:37467948-37467970 CTTTTATGACAGTGTGAAAACGG - Intergenic
1095453945 12:42362741-42362763 GATTTCCCACAGATGGAAAAAGG - Intronic
1096157382 12:49348042-49348064 CTTTGACCACAGAGTGAAAATGG - Exonic
1096746305 12:53729691-53729713 CATGTACTCCAGATGGAAAATGG + Intergenic
1096878234 12:54646978-54647000 CTTTTAGGAGACATGGAGAAGGG - Intronic
1097908574 12:64945433-64945455 ATATTACAACAGATGGGAAAGGG + Intergenic
1098905201 12:76154781-76154803 CTTTGGTGACTGATGGAAAAGGG + Intergenic
1100128115 12:91455501-91455523 CTTTCATGACAGTTGGAAATTGG - Intergenic
1102356944 12:112245310-112245332 CTCTTAAGACAGATACAAAATGG - Intronic
1103279596 12:119745537-119745559 TCCTTCCGACAGATGGAAAATGG + Intronic
1105561749 13:21498918-21498940 CTTTTCTGATAGATGAAAAATGG + Intronic
1105710535 13:23004394-23004416 CTTTTACGACACACACAAAAAGG - Intergenic
1105890226 13:24677307-24677329 CTTCTACCAAAGAAGGAAAATGG - Intergenic
1105961248 13:25342728-25342750 CTTTTAAGACATATTTAAAAGGG - Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106648646 13:31665129-31665151 CTTACACGACAGAAGGCAAAGGG + Intergenic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1111617340 13:90676964-90676986 CTATTTTGAGAGATGGAAAATGG + Intergenic
1113642931 13:111971176-111971198 CTTTTACATCAAATGGACAAGGG + Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1118012754 14:61626678-61626700 CTTTCACGATGGATGGAGAATGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119417340 14:74481317-74481339 CTGTTAGGACAGAAGGCAAAGGG - Intronic
1120167409 14:81216202-81216224 CTTATACGTAAGATGGAAATTGG - Intronic
1120902903 14:89591142-89591164 CCTTTACGACAGGCAGAAAAGGG + Intronic
1124467666 15:29953110-29953132 CTTTTATGAAAGAAGGAAGAGGG - Intronic
1124514145 15:30352009-30352031 CATTTACCACAGAAAGAAAAGGG + Intergenic
1124728775 15:32178755-32178777 CATTTACCACAGAAAGAAAAGGG - Intergenic
1125020652 15:34983018-34983040 CTTTTACCACAGAGGAAAGATGG - Exonic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1126840801 15:52715582-52715604 CTGTGACGAAAGAAGGAAAAGGG + Intergenic
1128642129 15:69347365-69347387 TTTTTCCGACTGATAGAAAATGG - Intronic
1130114657 15:80996269-80996291 CTTTTACAACAGATAGTGAAAGG + Intergenic
1130958271 15:88642437-88642459 CTGTTAAGATAGATGGAATATGG + Intronic
1131844182 15:96471329-96471351 CTTTGAAGACAGATTAAAAACGG - Intergenic
1133748903 16:8709254-8709276 CTTTTGGAACACATGGAAAAAGG - Intronic
1133909728 16:10054351-10054373 CTTATATGATAGATGTAAAACGG - Intronic
1138410552 16:56836190-56836212 TTTCTAAGACAGATGGCAAAAGG - Intronic
1138812794 16:60170772-60170794 CTTTCAAGACAGAAGGAATACGG + Intergenic
1140688331 16:77455113-77455135 CTTTTACGACACAGTTAAAAAGG + Intergenic
1148440631 17:47710012-47710034 CTTTCAGGACAGACAGAAAAGGG - Intronic
1149277450 17:55058481-55058503 CTTTTTTGACAGATGTAAAAGGG + Intronic
1151087676 17:71399219-71399241 CTTTTTCGACAGGGAGAAAATGG + Intergenic
1151551118 17:74823066-74823088 CTTTTAAGACAGAATGAAAAGGG - Intronic
1156067293 18:33159557-33159579 ATTTGACAACAGAAGGAAAAAGG - Intronic
1156635447 18:39022529-39022551 CTCTTAAGATAAATGGAAAAAGG - Intergenic
1159043925 18:63350679-63350701 AGTTAACGACAGATGCAAAATGG - Intronic
927921098 2:26972214-26972236 TTTTTACTCCAGATGGTAAAAGG + Intronic
929360156 2:41078244-41078266 CTTTTCCTACACATAGAAAAAGG - Intergenic
930148729 2:48035625-48035647 ATTTTCAGGCAGATGGAAAATGG - Intergenic
930306139 2:49677127-49677149 CTTCTCCTAGAGATGGAAAAGGG - Intergenic
932776689 2:74532180-74532202 ATTTACAGACAGATGGAAAATGG - Intronic
933295930 2:80491373-80491395 CTTTGAAGACAGATAGACAACGG + Intronic
939428319 2:142070212-142070234 CTTATAAGAGAGAAGGAAAAGGG + Intronic
940469413 2:154076164-154076186 ATCTTACGGCAAATGGAAAAGGG + Intronic
941064938 2:160891321-160891343 CTATTACTACAGGAGGAAAATGG + Intergenic
942385804 2:175441583-175441605 CTATCATGACAGATGGAAACTGG + Intergenic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943258482 2:185628468-185628490 CATTTATGGCAGAAGGAAAAGGG - Intergenic
943843393 2:192608024-192608046 CTATTACCACTTATGGAAAAGGG - Intergenic
945289296 2:208111898-208111920 CTTTTACGTCATCTGTAAAAAGG - Intergenic
945431487 2:209771146-209771168 CTATTACAACTGAAGGAAAATGG + Intergenic
946508491 2:220327505-220327527 TTTTTAGGGAAGATGGAAAATGG - Intergenic
946803422 2:223445257-223445279 CTCTGACTACAGATGGAAAATGG + Intergenic
948717312 2:239873589-239873611 CTCTTAAGAGAGATGGAAATTGG - Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1170280002 20:14635391-14635413 CTTTTTGGAAAGTTGGAAAATGG - Intronic
1171537665 20:25910709-25910731 CTTTTATGACAGTGTGAAAATGG - Intergenic
1171840606 20:30206049-30206071 CTTTTATGACAGTGTGAAAACGG - Intergenic
1174140579 20:48410706-48410728 CTTTTACCACATATGGATCAGGG + Intergenic
1174522125 20:51139715-51139737 CTTTTACGGTAGATGGGAATTGG + Intergenic
1175410343 20:58763575-58763597 CTTTTATGAATGAAGGAAAAGGG - Intergenic
1177253388 21:18626447-18626469 ATTTAACAACAGATTGAAAAAGG + Intergenic
1178995109 21:37392021-37392043 CATTTATGAAAGATGGATAATGG - Intronic
1179136825 21:38687094-38687116 CTTTTACGAGAAATGCAAATGGG - Intergenic
952284065 3:31950861-31950883 CTTTTACTCAAGATGGAAAGTGG - Intronic
953728584 3:45424698-45424720 CTCTGACGAAAAATGGAAAATGG - Intronic
955010099 3:55005399-55005421 CCCTTGTGACAGATGGAAAAAGG + Intronic
955386288 3:58483793-58483815 CTTTTGCTACAGAAGGAAAAAGG - Intergenic
956432072 3:69197539-69197561 CTTGTACACCAGATGGAAAGAGG + Intronic
956449006 3:69355005-69355027 CTTGTAGGATAAATGGAAAAAGG + Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
959180902 3:102979348-102979370 TTTTTATGACAGATAGCAAAAGG + Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
963257356 3:143159066-143159088 CTTGTAGGAAACATGGAAAAGGG - Intergenic
964680050 3:159328541-159328563 GTTTTACCTCAGGTGGAAAAGGG + Intronic
964729557 3:159850671-159850693 CAATTACGACAGAAGGCAAAGGG + Intronic
965877192 3:173340133-173340155 CATTTACAACAGACTGAAAATGG + Intergenic
968207448 3:196816245-196816267 CCTTAATGACAGATGGAAAAGGG - Intronic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
970345381 4:15147801-15147823 CTTTTGTGCCAGATGGAAGAAGG - Intergenic
971522447 4:27571040-27571062 CTTTTACCACAACTGGGAAAGGG + Intergenic
976680362 4:87749047-87749069 CGTTTAAGACTGATGGAACATGG + Intergenic
977783304 4:101004809-101004831 CATTTACGGCAGAAGGCAAAGGG - Intergenic
977841101 4:101706148-101706170 ATTTTGCAAAAGATGGAAAAGGG - Intronic
981258905 4:142696218-142696240 CTTATCAGACACATGGAAAAGGG - Intronic
982150432 4:152449349-152449371 CTTTGAGGACTGATGGAAGAGGG + Intronic
985209425 4:187576457-187576479 ATTTTACCACAGTTGCAAAAAGG + Intergenic
986225149 5:5805353-5805375 TTTCTACCACAGATGAAAAATGG - Intergenic
986262534 5:6160769-6160791 CTTTTAAAACAGAAGGAAAGTGG + Intergenic
987971342 5:24948721-24948743 CCATTATGACAGATGAAAAATGG - Intergenic
991232080 5:64345679-64345701 CTGTCATGACAGATGTAAAAAGG + Intronic
993123961 5:83809101-83809123 CTTTTTCTACATATGGAATATGG + Intergenic
993524145 5:88943754-88943776 CTTTTGCCACAGAAAGAAAAGGG + Intergenic
994145401 5:96389257-96389279 CTTTTACCACAAAAGAAAAAAGG + Intergenic
996436392 5:123437482-123437504 ATTTTACTAAAGAGGGAAAAAGG + Intergenic
998254400 5:140573742-140573764 CTTTTACCACCTATGGAGAAAGG + Intronic
1001503319 5:172255786-172255808 CTTTTAAGATAGATGGCAAGGGG + Intronic
1002682446 5:180977780-180977802 CTTTTAATAAACATGGAAAACGG - Intergenic
1003579513 6:7326978-7327000 TTTTTATTACATATGGAAAAGGG + Intronic
1004166676 6:13262816-13262838 ATTTTCAGACAGATGGAAAGAGG - Intronic
1004944832 6:20600406-20600428 GTTTAACCACAAATGGAAAAAGG - Intronic
1008135372 6:47770252-47770274 CTTTTACTAATGATGAAAAATGG + Intergenic
1010837584 6:80609185-80609207 CTTTTTGAAAAGATGGAAAAAGG + Intergenic
1013028161 6:106300865-106300887 CTTTCAGGACAGGTGGTAAAAGG - Intronic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1019425105 7:971379-971401 ATTTTAGCACAGAAGGAAAAAGG + Intronic
1022759370 7:33330875-33330897 CTTTTAAGACAGAAGCAATAGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1028908008 7:96176370-96176392 CTTTTGAGGCAGTTGGAAAATGG - Intronic
1030190143 7:106802355-106802377 CTATTACTACAGATTGAGAAGGG + Intergenic
1030986582 7:116248476-116248498 CTATTCCGACTGATGGAAGATGG + Intronic
1032454568 7:132063730-132063752 TTTGCAAGACAGATGGAAAAAGG + Intergenic
1032878877 7:136067164-136067186 CTTTTAAGAAACAAGGAAAAAGG - Intergenic
1035729880 8:1846316-1846338 CTTTTACGACAAATAGAAATAGG + Intronic
1037259810 8:16995920-16995942 GTTTTATGACAGATGAAAAAAGG + Intronic
1038615112 8:29086554-29086576 CTTTCATGACAGGTGGGAAATGG + Intronic
1042258986 8:66837467-66837489 CTTTTGTGACAGATGTAGAAAGG - Intronic
1042381493 8:68119567-68119589 CTTTTACTGCATATGAAAAAGGG - Intronic
1043447700 8:80335264-80335286 CTTTAATGACAGAAGAAAAATGG - Intergenic
1043646385 8:82525210-82525232 CTTTTGAGAGAGAAGGAAAATGG + Intergenic
1044175186 8:89111400-89111422 CTTTTACAAGAAATGGTAAAGGG + Intergenic
1044187683 8:89275454-89275476 CTTTTATAAAAGAAGGAAAAAGG + Intergenic
1045052749 8:98341886-98341908 CTCTTACAACAGCTGGCAAATGG + Intergenic
1046401118 8:113704410-113704432 CTTTTGTTACAGAAGGAAAATGG + Intergenic
1051663983 9:19451036-19451058 CCTTTCCCAAAGATGGAAAATGG + Exonic
1051963264 9:22794179-22794201 ATTTTACTACACATGGCAAAAGG - Intergenic
1052017420 9:23485123-23485145 CCCTTCCTACAGATGGAAAAAGG + Intergenic
1052597731 9:30582088-30582110 TTTTTAAGACAGAAGGAATACGG + Intergenic
1057100726 9:92357229-92357251 CTCTTAGAACATATGGAAAAAGG - Intronic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1187597605 X:20790955-20790977 CTTTTCTCACAAATGGAAAAGGG - Intergenic
1192239514 X:69318288-69318310 CTCTTTTGACAGATGGGAAAAGG + Intergenic
1193945728 X:87731495-87731517 CTTTTACTACATATAGGAAAAGG - Intergenic
1193995045 X:88355268-88355290 TTCTTATGGCAGATGGAAAAGGG + Intergenic
1194648347 X:96485723-96485745 ATTTTACTAAAGAGGGAAAAAGG - Intergenic
1199372558 X:147068455-147068477 CATTTATGACAGAGGGCAAAAGG + Intergenic