ID: 901839578

View in Genome Browser
Species Human (GRCh38)
Location 1:11945398-11945420
Sequence CTGGGCAACGGGAGTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901839573_901839578 -8 Left 901839573 1:11945383-11945405 CCTCTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG 0: 1
1: 0
2: 1
3: 20
4: 209
901839569_901839578 10 Left 901839569 1:11945365-11945387 CCATGAGCCATGATTGTGCCTCT 0: 2
1: 57
2: 237
3: 689
4: 1842
Right 901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG 0: 1
1: 0
2: 1
3: 20
4: 209
901839570_901839578 3 Left 901839570 1:11945372-11945394 CCATGATTGTGCCTCTGCACTCC 0: 31
1: 2137
2: 21367
3: 67682
4: 130774
Right 901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG 0: 1
1: 0
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901839578 Original CRISPR CTGGGCAACGGGAGTGAGAT TGG Intronic
900649758 1:3725070-3725092 CTGGGAAACAGGAGTGTGCTGGG + Intronic
901839578 1:11945398-11945420 CTGGGCAACGGGAGTGAGATTGG + Intronic
905313009 1:37063581-37063603 CTCGGCACAGGGAGTGAGATAGG + Intergenic
905348648 1:37328924-37328946 CAGGGGAAGGGGAGAGAGATGGG + Intergenic
906336241 1:44934095-44934117 CTGGGCAACAAGAGTGAAACAGG + Intronic
911347990 1:96720579-96720601 CTGGGCAACAAGAGCGAGACTGG + Intergenic
912812590 1:112805269-112805291 AGGGGCAACAGCAGTGAGATTGG + Intergenic
913972148 1:143423614-143423636 CTGTGCAGCCGGAGTCAGATGGG + Intergenic
914066529 1:144249227-144249249 CTGTGCAGCCGGAGTCAGATGGG + Intergenic
914112624 1:144717127-144717149 CTGTGCAGCCGGAGTCAGATGGG - Intergenic
917057048 1:170994737-170994759 CTGGGAAAGGGTAGTGGGATGGG - Intronic
919086626 1:192928543-192928565 CAGGGCAACGGAAGGGAGGTTGG + Intergenic
921304186 1:213779378-213779400 CTGAGCACCAGGAGTTAGATAGG - Intergenic
921534230 1:216325532-216325554 CAGGGCAACGGCAATGTGATTGG + Exonic
921593863 1:217033924-217033946 CTAGGGAATGGCAGTGAGATTGG + Intronic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
922152655 1:223018724-223018746 CCGGGCAACTGGAGAGAGCTGGG + Intergenic
922398915 1:225230586-225230608 GTGGGTAATGGGAGTGAGAGGGG + Intronic
922929690 1:229379277-229379299 CTAGGGAACTGCAGTGAGATGGG - Intergenic
923660607 1:235954146-235954168 CTAGGCAATGGGAGAGAGTTTGG + Intergenic
924041424 1:239988078-239988100 CTGGGCAGCAGGAGTGGGAGTGG + Intergenic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
924653225 1:245949134-245949156 CTGGGCAATGGGCGTGGCATAGG - Intronic
924696111 1:246401745-246401767 CTGGGCAACAAGAGTGAAACTGG - Intronic
924938823 1:248795680-248795702 CTGGGAAAAGGCAGTGAGAAAGG - Intergenic
1062770306 10:94780-94802 CAGGGCAACAGGAGAGAGAGAGG + Intergenic
1062986192 10:1771518-1771540 CTGGTCAAGGTGACTGAGATAGG - Intergenic
1063251608 10:4280845-4280867 GAGGGCCACTGGAGTGAGATGGG - Intergenic
1065783569 10:29192709-29192731 CGAGGCAACTGGAGTGAGGTGGG + Intergenic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1067563441 10:47320132-47320154 CTGGGAAGCGGGAGGGAGAGAGG - Intergenic
1068663651 10:59649414-59649436 CTGGCCACAGGGACTGAGATAGG + Intergenic
1069544822 10:69320335-69320357 GTGGGGACCGGGAGTGAGGTAGG + Intronic
1069942147 10:71963716-71963738 CTGGGAAACGGGAGGGACAGAGG - Intergenic
1070328804 10:75403970-75403992 GTGGGGGAGGGGAGTGAGATGGG - Intergenic
1071809900 10:89168075-89168097 CTGGGCAAAGGCTGTGAGTTGGG - Intergenic
1072796239 10:98356976-98356998 CTGGGCAGCAGGAGAGAGATAGG + Intergenic
1073116166 10:101093179-101093201 CTGGCCACAGGGAGGGAGATGGG + Intronic
1074305049 10:112269245-112269267 CTGGTAAAAGGGAGTGAGGTGGG - Intergenic
1079001708 11:16763033-16763055 CTGGGCAACAAGAGTGATGTTGG + Intergenic
1079025758 11:16946391-16946413 CTGGTCATAGGGAGTGAGAAAGG - Intronic
1081807565 11:45898838-45898860 CTGGGTAACTGGGGTCAGATGGG + Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1085289299 11:75386050-75386072 CTGGGCAAGGGGAGCGAGTGGGG + Intergenic
1085493506 11:76945756-76945778 CTGGGCAGCTGGTGTGATATGGG + Intronic
1087121826 11:94583128-94583150 CTAGGGAGCGGGAGGGAGATGGG - Intronic
1087969582 11:104462900-104462922 CTGGGAAATGTGAGTGAGATTGG - Intergenic
1088720437 11:112587466-112587488 CTGGGCAAAGGGGATGGGATTGG + Intergenic
1090288474 11:125520698-125520720 TAGGGCTAGGGGAGTGAGATAGG + Intergenic
1090796527 11:130140336-130140358 CTGTGCAATGGGTGTGAGATGGG + Intronic
1091788936 12:3260146-3260168 CCGCTCAACGGGAGTCAGATGGG + Intronic
1091810139 12:3390057-3390079 CTGGGCATGGGGAGAGAGAGTGG + Intronic
1096432136 12:51554724-51554746 CTGAGGAAAGGGAGAGAGATGGG + Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1098038772 12:66333775-66333797 CAGGGCCACGGGAATGAGTTGGG + Intronic
1098150402 12:67540593-67540615 CTGGGCAACTGGAGGGATAGTGG + Intergenic
1099144588 12:79024229-79024251 CTGGGTAATGGGATTGAGAGAGG + Intronic
1101974450 12:109343794-109343816 CTGGGAAACAGGAGTGGGATGGG + Intergenic
1102233196 12:111277571-111277593 TGAGGCAACTGGAGTGAGATGGG - Intronic
1104348709 12:128026176-128026198 TGGGGTCACGGGAGTGAGATTGG + Intergenic
1104920450 12:132287826-132287848 CAGGGGGACGGGAGTGAGAGGGG + Intronic
1104976380 12:132553739-132553761 CGGGGCAATGGGAGTGCGAGGGG + Intronic
1105996508 13:25677663-25677685 GAGGACAACGGGAGAGAGATAGG + Intronic
1106000216 13:25715493-25715515 CTGGGGAACTGGAGAGACATTGG - Intronic
1108453048 13:50586411-50586433 CTGAGCAGCGGGAGAGGGATGGG - Intronic
1108972541 13:56394967-56394989 CTGGGGGAGGGGAGTGGGATGGG + Intergenic
1109772821 13:66999115-66999137 CTGAGCAAAGGCAGAGAGATAGG - Intronic
1112162767 13:96886321-96886343 CTGGGGGAAGGGAGAGAGATGGG + Intergenic
1113442154 13:110337492-110337514 ATGGGCAGTGGAAGTGAGATTGG + Intronic
1114193020 14:20454931-20454953 CTGGACCACGGGAAAGAGATAGG - Exonic
1116206595 14:41875191-41875213 CTGGGAAAGGGGAGTGATGTGGG - Intronic
1116385764 14:44327803-44327825 TAGGGCAAAGGGAGTGAGGTGGG + Intergenic
1119246711 14:73115927-73115949 CTGGGTATTGGGAGTCAGATTGG + Intronic
1119675951 14:76554419-76554441 CTGGGCAACAAGAGTGAACTCGG - Intergenic
1119793581 14:77376504-77376526 CTGGGGCAGGGGACTGAGATGGG + Intronic
1122116083 14:99527911-99527933 CTGGGCAAGGTGCGTGAGAAGGG + Intronic
1123433275 15:20236230-20236252 CTGGGCAATGGGAGTGGGGAGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1125653921 15:41340334-41340356 CTGGGCAACTGGGGTGGGGTGGG - Intronic
1126456857 15:48872328-48872350 GTGGGCAAGGGCAGTGAGATGGG - Intronic
1126677340 15:51171803-51171825 CTGGGGAACGGCAGGGAGATAGG - Intergenic
1126801714 15:52304039-52304061 TTGGTCAACAGAAGTGAGATGGG - Intergenic
1132322366 15:100935394-100935416 CTGGGCAGCGGGAATGAGCTCGG + Intronic
1132747593 16:1443408-1443430 CTGGGCAGCAGGGGTGAGCTGGG + Intronic
1133295393 16:4749417-4749439 CAAGGCAAGGGGAGTGAGGTAGG + Exonic
1133639591 16:7703928-7703950 CTGGGCAAGGAGGGAGAGATTGG + Intronic
1134406331 16:13962220-13962242 GTGGGGAATGGGAGTGAGACTGG - Intergenic
1135024285 16:18987197-18987219 CTGGTCAGAGGAAGTGAGATGGG - Intronic
1136851350 16:33614892-33614914 CTGGGCAATGGGAGTGGGGAGGG + Intergenic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1142597295 17:1035794-1035816 CTCTGCAAGGGGAGTGAGAGGGG + Intronic
1143165128 17:4893738-4893760 CAGGGCAGCGGGAGAGAGACAGG - Intronic
1145004265 17:19328644-19328666 CTGGGCAGCTGGGGTGAGAAGGG - Intronic
1147262714 17:39217972-39217994 CTGGGCATGGGGAGGGGGATGGG + Exonic
1147403666 17:40195532-40195554 CAGGGCAACGGGAGGGGGCTGGG - Exonic
1147698742 17:42377841-42377863 CTGAGTAATGGGAATGAGATTGG - Intronic
1148324951 17:46777893-46777915 CTGGGCAACAGGAAGGAGACAGG - Intronic
1149251060 17:54769912-54769934 CTGGGCATTGGCAGTGAGAATGG + Intergenic
1151978766 17:77497236-77497258 CTGGGCAGGGGGAGAGAGGTGGG + Intronic
1154004539 18:10515817-10515839 CTGAGCTACAGGAGTGAGACAGG + Intergenic
1154264218 18:12865664-12865686 CTGGGCAAAAAGAGTGAGCTGGG + Intronic
1156851967 18:41739083-41739105 CAGGGGAGAGGGAGTGAGATGGG - Intergenic
1161250039 19:3275623-3275645 CTGGGCAAAGGCCGGGAGATGGG + Intronic
1162568716 19:11458399-11458421 CTGGGCAAAGGCAGTCAGGTGGG - Intronic
1163765889 19:19163021-19163043 CCGGGCAAAGGGAGAGTGATGGG - Intronic
1165022597 19:32936404-32936426 CTGGGCAGCAGGAGGGAGACAGG + Intronic
1165488873 19:36111725-36111747 CAAGGCAACAGGAGTGCGATGGG + Intronic
1166417339 19:42605656-42605678 GTGGGCAACAGGTTTGAGATTGG + Intronic
1167465146 19:49646635-49646657 CTGGGCAGCTGGAGTGGGAGAGG + Intronic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
927259456 2:21072461-21072483 ATGGGGATCGGGAGTGAGATGGG + Intergenic
928219825 2:29394517-29394539 CTGGGCAGGGGAAGTGAGAGGGG + Intronic
929642532 2:43596046-43596068 CAGGGCAAAGGGAGGGAGAGAGG + Intronic
929749967 2:44700554-44700576 CTGGGGAGAGGGAGAGAGATGGG + Intronic
930882637 2:56289464-56289486 TTGGGCAAAGGGGGTGATATGGG + Intronic
931758637 2:65396609-65396631 CTGAGCAACAGGACAGAGATGGG + Intronic
934176845 2:89584551-89584573 CTGTGCAGCCGGAGTCAGATGGG + Intergenic
934287152 2:91658911-91658933 CTGTGCAGCCGGAGTCAGATGGG + Intergenic
934917326 2:98310798-98310820 CTGGGCGACAGCAGTGACATTGG - Intronic
939956271 2:148530054-148530076 CTGGACAACGGCAGTGGGAATGG - Intergenic
941503760 2:166313959-166313981 CTGAGGAAAGGGAGAGAGATAGG + Intronic
942677232 2:178440658-178440680 CTGGGAAAATGGAGAGAGATGGG - Intronic
944267690 2:197746948-197746970 CTGGGGATGGCGAGTGAGATGGG + Intronic
946334257 2:219027068-219027090 CTGGGCAAGGGCAGTGGGGTGGG + Intronic
947162532 2:227228552-227228574 CTGGGCTGCGGGAGAGAGATTGG + Intronic
948136945 2:235643404-235643426 CTGGGCAACAAGAGAGAGACTGG + Intronic
1168967895 20:1910439-1910461 CTGGGAAATGGGACTGAGGTAGG - Intronic
1168971601 20:1935063-1935085 CTGGGCAAATGTAGAGAGATGGG - Intronic
1169044914 20:2527535-2527557 CTTGGCAAAGGGAGTGGGAATGG - Intergenic
1172236349 20:33378265-33378287 CTGAGGAAAGGGAGAGAGATGGG + Intronic
1174037450 20:47677023-47677045 CTGGGCAGAGGGAGGGAGGTGGG + Intronic
1175498043 20:59428772-59428794 CAAGGCAAGGGGAGTGAGGTTGG + Intergenic
1175771656 20:61628026-61628048 CTGGGCCACAGGGGTGAGGTGGG - Intronic
1177149081 21:17436595-17436617 CTGGGAAACTGGAATGAAATGGG - Intergenic
1178686258 21:34713008-34713030 GAGGGCAAAGGGAGTGAGACAGG - Intronic
1179491484 21:41744225-41744247 GTGGGCCACGGGAGGGAGATGGG + Intronic
1179963850 21:44788757-44788779 GTGGGCAACCAGAGTGAGACTGG + Intronic
1180927420 22:19565969-19565991 CTGGACAACGGGGGAGGGATGGG - Intergenic
1183612553 22:38920018-38920040 CAGGGCAGAGGGAGAGAGATGGG + Intergenic
1183718427 22:39548011-39548033 CTGGGCAAGGGGAGTGGGGTGGG + Intergenic
1183740435 22:39665858-39665880 CTGGGGAAAGGGGGTGAGGTTGG - Intronic
1184490454 22:44805290-44805312 CCGGGTACCGGGAGTGTGATGGG + Intronic
1184994964 22:48198968-48198990 CTGGGCAGAGGGAGTGATGTAGG + Intergenic
1185041357 22:48506104-48506126 CTGGAGACAGGGAGTGAGATAGG - Intronic
1185043932 22:48519573-48519595 CTGGGCCACGAGAGAGGGATGGG + Intronic
950259910 3:11536160-11536182 CCGGGCCAGGGGAGTGGGATTGG + Intronic
950553943 3:13684131-13684153 CCGGCCCATGGGAGTGAGATGGG + Intergenic
950634968 3:14308081-14308103 CTGGGCATCGGGAGTCAGATGGG - Intergenic
952771786 3:37008005-37008027 CTGGGCAACAAGAGTGAAACAGG + Intronic
953483968 3:43277011-43277033 CTGAGGAAAGGGAGAGAGATGGG - Intergenic
954692895 3:52405161-52405183 CTGGACAATGGGAGTGGGGTTGG + Exonic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
956302741 3:67790284-67790306 CTTGGCAACTGGAGTGAGAGTGG - Intergenic
961654158 3:128432488-128432510 CTGGGCAGCGGGAGTGTGGAGGG + Intergenic
961703129 3:128762570-128762592 CTGGGAGTGGGGAGTGAGATGGG + Intronic
964116007 3:153137074-153137096 CTGGGCAACAAGAGTGAAACTGG - Intergenic
966914778 3:184578612-184578634 CAGGGTACCCGGAGTGAGATAGG - Intronic
967566399 3:190978749-190978771 CAGGGCAACAGGAGAGAGGTTGG - Intergenic
968841508 4:3009962-3009984 CTGGGCAAAGTGACTGAGCTGGG - Intronic
970596552 4:17605430-17605452 CTGGGACTCGGGAGAGAGATGGG - Intronic
972960267 4:44446538-44446560 CTGGGGATTGGGAGTGGGATTGG - Intronic
976671531 4:87659979-87660001 CTGGGCTCTGGGAGTGAGAAAGG + Intronic
977827064 4:101545286-101545308 CTGGGAAACGGGAGGCAGAGAGG + Intronic
978431812 4:108640664-108640686 CTGAGCAAAGGCAGAGAGATGGG - Intergenic
979590328 4:122471783-122471805 CTGGGGAAAGGGAGAGAGACAGG - Intergenic
980798031 4:137711024-137711046 CTGGGCAGTGGGTGTGACATGGG + Intergenic
981579023 4:146233726-146233748 CTGGGCCAGGGAAGTGAGGTGGG - Intergenic
982439102 4:155414044-155414066 CTGAGCAGAGGGAGAGAGATGGG + Intergenic
985088079 4:186334853-186334875 CTGAGAAAAGGGAGAGAGATGGG - Intergenic
985185605 4:187311865-187311887 CTGAGGAGCGGGAGAGAGATTGG + Intergenic
985955434 5:3262166-3262188 CAGGGCAACAGGAGGGAGAAGGG - Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986902661 5:12456142-12456164 CTGGGCAACAAGAGTGAAACTGG - Intergenic
987123762 5:14792223-14792245 CTGGGCAGGGGAATTGAGATTGG + Intronic
992775398 5:80084532-80084554 CTGGGCAATGAGAGTGAGGCTGG + Intergenic
995880696 5:116841603-116841625 CTGGGCAACAAGAGTGAACTTGG + Intergenic
998271159 5:140707928-140707950 CTGGGCAACTGGGGGCAGATTGG + Intergenic
1005449638 6:25960336-25960358 ATGGGAAACAGGTGTGAGATGGG + Intergenic
1005896190 6:30181460-30181482 CTGGGCAGCTGGTGTGAAATGGG + Intergenic
1006473267 6:34239971-34239993 CTGCCCAACTGGAGTCAGATGGG - Intronic
1006740676 6:36306255-36306277 ATAGGAAACGGGAGTGAGATGGG - Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1007393883 6:41566252-41566274 CTGGGCAGCAGGCTTGAGATTGG + Intronic
1008528649 6:52434007-52434029 CGGGACAGTGGGAGTGAGATTGG - Intronic
1010641009 6:78327213-78327235 CTGGGCATAAGGAGTTAGATGGG + Intergenic
1011160140 6:84380817-84380839 CTGGGCAGCTGGTGTGACATGGG + Intergenic
1011497447 6:87950499-87950521 CAGGGCAATGGCACTGAGATGGG - Intergenic
1018748384 6:166780352-166780374 CTGGCCATGGGGAGAGAGATGGG + Intronic
1020209786 7:6150060-6150082 CTGGGCAAGGAGAATGGGATTGG + Exonic
1029216184 7:98951862-98951884 CTGGGCAAGTGTAGGGAGATGGG + Intronic
1030291550 7:107877971-107877993 CTGGGCAATGGGCATGAGACCGG + Intergenic
1031995702 7:128229220-128229242 CTAGGAAAAGGAAGTGAGATGGG - Intergenic
1033344670 7:140517845-140517867 CTGGGCCCCTGGAATGAGATGGG + Intergenic
1034015092 7:147574430-147574452 CAGGGCAATGGGAGTAAAATGGG - Intronic
1035074222 7:156167984-156168006 CTGGGCAACTGGAGACAGAGAGG + Intergenic
1035588655 8:796532-796554 CTGAGCAAAGGGAGTGGCATGGG - Intergenic
1039910941 8:41826390-41826412 CTGGGCAGCAGGAGTGAGCATGG - Intronic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1043772494 8:84223059-84223081 CAGGGCAAAGGGAGAGAGAAAGG - Intronic
1045054606 8:98358313-98358335 TTGGGTAACGGGCGTGTGATTGG - Intergenic
1046207980 8:111028046-111028068 CTTGGCAAATGGTGTGAGATGGG - Intergenic
1047214059 8:122862763-122862785 CTGGGCGTGGGGAGTGAGAACGG + Intronic
1047762272 8:127963028-127963050 CTGGCCTGCGGGATTGAGATCGG + Intergenic
1049436855 8:142590427-142590449 ATGGGCATGGGGAGGGAGATGGG - Intergenic
1050712381 9:8480275-8480297 CTGGGCCATGGGAGTGGGAGTGG - Intronic
1051777798 9:20655455-20655477 CTGAACAAAGGGAGAGAGATGGG + Intergenic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1053916190 9:42947050-42947072 CTGGGCAACGGGGGTCTGAGCGG + Intergenic
1056433882 9:86556390-86556412 CTGGGCAACAAGAGTGAAACTGG + Intergenic
1057083472 9:92189351-92189373 CTGGGCCCCGGGAGTGGGGTGGG - Intergenic
1057287370 9:93768884-93768906 CTGGGGAAAGGAAGAGAGATGGG + Intergenic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059461104 9:114430736-114430758 CTGGGGAACGGCTGTGAAATGGG + Intronic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1190974979 X:55389983-55390005 CTAGGCAACTGGAGTGACATGGG - Intergenic
1192200089 X:69061131-69061153 CTGGGCAGTGGGAGTGTGTTGGG - Intergenic
1192418032 X:71002037-71002059 CTGGGCAATAAGAGTGAGATTGG + Intergenic
1192433213 X:71126313-71126335 AAGGGCAGTGGGAGTGAGATGGG - Intronic
1193787341 X:85775209-85775231 GTGGGAAAGGGGTGTGAGATTGG - Intergenic
1194998896 X:100622777-100622799 CTGGGCAGTGGGAGTGAGGGTGG + Intergenic
1198030107 X:132746609-132746631 CTAGGCAGAGGGAGTGAGGTGGG - Intronic
1198458731 X:136842949-136842971 CTGGGCAACAGGAGCGAAACTGG + Intergenic
1200686249 Y:6262915-6262937 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200989132 Y:9333831-9333853 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200991789 Y:9354161-9354183 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200994443 Y:9374441-9374463 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1200997106 Y:9394787-9394809 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1200999622 Y:9463325-9463347 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201002280 Y:9483633-9483655 CAGGGCAGCGGGAGTGAGGATGG + Intronic
1201004939 Y:9503920-9503942 CAGGGCAGCGGGAGTGAGGATGG + Intergenic
1201007597 Y:9524247-9524269 CAGGGCAGCGGGAGTGAGGATGG + Intergenic