ID: 901839919

View in Genome Browser
Species Human (GRCh38)
Location 1:11947759-11947781
Sequence TCGGTCAGTTACTGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901839919 Original CRISPR TCGGTCAGTTACTGGGTGGA GGG Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901839919 1:11947759-11947781 TCGGTCAGTTACTGGGTGGAGGG + Intronic
901912768 1:12473866-12473888 TGGTTGAGTTGCTGGGTGGAGGG + Intronic
902163537 1:14551653-14551675 TTGGTGAGTTAGTGGGTGGAGGG + Intergenic
902397892 1:16142508-16142530 TGGGTGAGTTGGTGGGTGGATGG + Intronic
903799558 1:25956487-25956509 TGGGTCAGGTACTTGGTTGATGG - Intergenic
905335504 1:37241817-37241839 TCGACCAGGCACTGGGTGGAGGG + Intergenic
906108095 1:43306635-43306657 TTGGTGATTTACTGGGTGGCTGG + Intronic
908708441 1:66988386-66988408 TCAGTCTGTAAGTGGGTGGATGG - Intronic
910645361 1:89508519-89508541 TGAGTCAGTTTCTGGGTGGGGGG + Intergenic
916471006 1:165122429-165122451 TTGGTCAGATACTTGGTAGAAGG + Intergenic
916544751 1:165793196-165793218 TCTGTCAGTTTCTGAATGGAAGG - Intronic
916629666 1:166598742-166598764 TCGGTCACTTTCTGGCTCGAAGG - Intergenic
918043171 1:180925653-180925675 TCGGCCAGTTTCCTGGTGGAGGG - Intronic
918307273 1:183258787-183258809 TGAGTCAGTTCCTGGGTGGGGGG - Intronic
919895665 1:202008342-202008364 TGGGTGAGGGACTGGGTGGAGGG + Exonic
921283950 1:213592178-213592200 GCTTTGAGTTACTGGGTGGAAGG + Intergenic
923124119 1:231020721-231020743 TCAGTCAGTTACTCTGGGGAGGG - Intronic
923916828 1:238516461-238516483 TGAGTCAGCTCCTGGGTGGAGGG - Intergenic
924477152 1:244392485-244392507 TCGGTCAGCTACCTGGTGGCAGG - Intergenic
1063972771 10:11393056-11393078 GCTGTGAGTTACTGAGTGGATGG + Intergenic
1064192587 10:13220540-13220562 TAGATCAGTTACCGAGTGGATGG - Intergenic
1067333287 10:45341235-45341257 TCAGTCTGTTACCTGGTGGAAGG + Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1070544252 10:77440192-77440214 TGGGCCAGATGCTGGGTGGAGGG + Intronic
1074079547 10:110156818-110156840 TGGGGCAGCCACTGGGTGGAGGG + Intergenic
1076278249 10:129224121-129224143 TGGGTGAGTTAACGGGTGGATGG + Intergenic
1076278304 10:129224376-129224398 TGGGTGAGTAAATGGGTGGATGG + Intergenic
1076648839 10:131973248-131973270 TCTGGCAGGTGCTGGGTGGAAGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1079081048 11:17413993-17414015 TTGGTCACTTACTGGCTGGGTGG + Intronic
1081514676 11:43815202-43815224 TCTGTCAGTTGCTGGATGGTAGG + Intronic
1082867474 11:57912974-57912996 TGAGTCAGTTCCTGGGTGCAGGG + Intergenic
1088123943 11:106400729-106400751 TCAGTCACTTACTAGGTGGGTGG + Intergenic
1091069724 11:132551652-132551674 TGAGTCAGTTCCTGGGTGGAGGG - Intronic
1093691451 12:22114164-22114186 TGAGTCAGTTCCTGGGTGGGGGG - Intronic
1095887689 12:47206059-47206081 TGAGTCAGTTCCTGGGTGGAGGG + Intronic
1099804309 12:87498632-87498654 TCAGCCAGCTACTGGGTGGCAGG - Intergenic
1100367390 12:93934281-93934303 GCCTTCAGATACTGGGTGGAGGG - Intergenic
1100829434 12:98504137-98504159 TCCGACAGATACTGGGTGGAGGG + Intergenic
1106005944 13:25770385-25770407 TCAGTCAGTTCCTGGGTGGTGGG - Intronic
1110875538 13:80504822-80504844 TATGTCAGATACTGAGTGGAGGG + Intergenic
1111476957 13:88762138-88762160 TAAGTCAGTTCCTGGGTAGAGGG - Intergenic
1119540748 14:75436637-75436659 GTGGTCAGTAACTGGATGGATGG + Intronic
1122380217 14:101298240-101298262 TAAGTCAGTTCCTGGGTGGGGGG + Intergenic
1122923752 14:104890587-104890609 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1123872758 15:24593317-24593339 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1125818115 15:42603745-42603767 TGAGTCAGTTATTGGGTGGGAGG + Intronic
1129227654 15:74179341-74179363 TGGGCCAGACACTGGGTGGAAGG - Intergenic
1129754290 15:78087342-78087364 GTGGTTAGTAACTGGGTGGATGG + Intronic
1132644774 16:993829-993851 TGGGTGAGTGAGTGGGTGGACGG - Intergenic
1135978664 16:27129122-27129144 TTGGACAGTTTCTGGGAGGAGGG - Intergenic
1137042473 16:35625850-35625872 TAAGTCAGTTCCTGGGTGGGGGG - Intergenic
1141048868 16:80742735-80742757 TGGGTGAGTGAGTGGGTGGATGG + Intronic
1143535775 17:7538444-7538466 TGAGTCAGTTTCTGGGTGGGGGG + Intergenic
1148648724 17:49234328-49234350 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1150319730 17:64202494-64202516 TTGGTCAGATCCTGGGTGGGGGG - Intronic
1154377614 18:13822952-13822974 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377666 18:13823114-13823136 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1154377700 18:13823226-13823248 TGGGTCAGTGGGTGGGTGGATGG - Intergenic
1158023640 18:52870692-52870714 TGAGTCAGTTGCTGGGTGGGGGG - Intronic
1158211401 18:55054498-55054520 TCCCTGAGTTATTGGGTGGATGG - Intergenic
1158863070 18:61612014-61612036 TGAGTCAGTTCCTGGGTTGAGGG + Intergenic
1160958345 19:1705694-1705716 TGGGTCAATAATTGGGTGGATGG + Intergenic
1161565454 19:4999681-4999703 TAGGTGAGTAAATGGGTGGATGG - Intronic
1161565524 19:4999949-4999971 TAGGTGAGTAAATGGGTGGATGG - Intronic
1163494018 19:17634204-17634226 TGGGTCATTTAATGGGTGGGTGG - Intronic
1166821407 19:45582656-45582678 TCAGTCAGTTCCTGGGTTGGGGG + Intronic
1167254416 19:48418697-48418719 TGGGCCTGTGACTGGGTGGATGG + Intronic
925170972 2:1750425-1750447 TAGGTGAGTTGATGGGTGGATGG - Intergenic
925772603 2:7298027-7298049 TCAGCCAGCTACTTGGTGGAGGG - Intergenic
926766486 2:16326575-16326597 TTGGTAAGTCACTGTGTGGAGGG - Intergenic
928179512 2:29058145-29058167 TAGATCTGTTACTGGGGGGAAGG + Exonic
928296513 2:30088769-30088791 TGAGTCAGTTCCTGGGTGGGGGG - Intergenic
928635078 2:33237019-33237041 TGGGACAGTTACAGGGTGGTGGG + Intronic
928791249 2:34956949-34956971 TCCTTCTGTTTCTGGGTGGAGGG + Intergenic
937303561 2:120857573-120857595 TGGATCAGTTAATGGGTGGGTGG - Intronic
937531320 2:122830609-122830631 TAGGTCAGCTACTTGGTGGCAGG + Intergenic
939069224 2:137518875-137518897 TCGGCCAGCTACTTGGTGGCAGG + Intronic
939865991 2:147473010-147473032 TCTGTCACTTTCTGGGTAGATGG - Intergenic
940235460 2:151506582-151506604 TCAGTCAGTTATTTGGGGGAGGG + Intronic
940650040 2:156433424-156433446 TAAGTCAGTTCCTGGGTGGAGGG - Intergenic
1176092147 20:63322950-63322972 TAGGACAGTCGCTGGGTGGAAGG + Intronic
1177338152 21:19760557-19760579 TCAGGAAGTTAATGGGTGGAGGG - Intergenic
1177530431 21:22351926-22351948 TGGGTCAGTTCCTGGGCGGGGGG + Intergenic
1177782350 21:25634787-25634809 AAGGTCAGATACTGGGTGGGGGG - Intergenic
1178500721 21:33123691-33123713 TTTGTCAGTGGCTGGGTGGAGGG - Intergenic
1180901287 22:19375223-19375245 CTGGTCAGTTTCTGAGTGGAAGG + Intronic
949944478 3:9179066-9179088 TCCTGAAGTTACTGGGTGGATGG - Intronic
950541265 3:13614682-13614704 TGGGTGAGTGAATGGGTGGATGG - Intronic
951780421 3:26356824-26356846 GTGGTCAGTCACTGGCTGGAAGG + Intergenic
953612644 3:44460570-44460592 TAAGTCAGTTCCTGGGTGGGGGG - Intronic
954127571 3:48540468-48540490 TGGGTCAGTGCCTGGCTGGATGG - Intronic
957725922 3:84067156-84067178 TGAGTCAGTTACTGGGTGGTAGG + Intergenic
962824572 3:139088632-139088654 GCAGACAGTTCCTGGGTGGAAGG - Intronic
965700002 3:171450971-171450993 TTGGACAGTTTCAGGGTGGAAGG + Intronic
970629428 4:17924491-17924513 TCAGCCAGCTACTTGGTGGAAGG + Intronic
973785062 4:54325725-54325747 TGGGGCAGCTACTGGGCGGAGGG + Intergenic
984701931 4:182824145-182824167 TGATTCAGTTACTGGGTGGGGGG - Intergenic
988954196 5:36297943-36297965 TCTGTGAGTGACTAGGTGGAAGG + Intronic
990309498 5:54524391-54524413 TCCCTGAGTTACTGGGAGGAGGG - Intronic
990955197 5:61332983-61333005 TCCGTCAGTCCCTGGGTGGGGGG + Intronic
992539682 5:77751916-77751938 TCAGTCAGTTCCTGGGTAGGGGG + Intronic
995998599 5:118330599-118330621 TGGGTCTTTGACTGGGTGGATGG - Intergenic
1000724550 5:164753155-164753177 TCAGTCAGTTCCAGGGTGGAAGG + Intergenic
1001392286 5:171388512-171388534 TCGGCCAGTTACTGGGGGTGGGG + Intronic
1002420092 5:179141466-179141488 TTCGTCAGTTACTGGGGAGAGGG - Intronic
1004554145 6:16679261-16679283 TGGATGAGTTAGTGGGTGGATGG + Intronic
1017946480 6:159100349-159100371 TCGGGCAGTGACAGGGAGGATGG - Intergenic
1018083590 6:160279449-160279471 TCGGGCAGTGACTGTGTTGAGGG - Intergenic
1024775422 7:52779440-52779462 TGAGTCAGTTCCTGGGTGGTGGG - Intergenic
1025839594 7:65133255-65133277 GCCGTCTGTTACTGAGTGGAAGG + Intergenic
1025889972 7:65639896-65639918 GCCGTCTGTTACTGAGTGGAAGG + Intergenic
1026097573 7:67358583-67358605 TGAGTCAGTTCCTGGGTGGGAGG + Intergenic
1027994468 7:85407315-85407337 TCTGTCACTTACTGGTTGTACGG - Intergenic
1029559508 7:101293224-101293246 TGAGTCAGTTCCTGGGTGGTGGG - Intergenic
1031852504 7:126882089-126882111 ACCGTCTGTTACTGAGTGGAAGG - Intronic
1032718346 7:134530090-134530112 TCGATCACTTACTGGGTGTGTGG - Intronic
1033641944 7:143269674-143269696 TGGGTCAATTACTGGGGGAATGG - Intronic
1034440690 7:151084261-151084283 TTGGTGTGTTACTGTGTGGATGG + Intergenic
1034990239 7:155543327-155543349 TCTGTGAGCTGCTGGGTGGAAGG + Intergenic
1035338638 7:158146343-158146365 TGGGTAGGTTAGTGGGTGGAGGG - Intronic
1040569156 8:48592613-48592635 CCGGCCATTTGCTGGGTGGATGG + Intergenic
1043570677 8:81599337-81599359 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1044987768 8:97770023-97770045 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1045991867 8:108317150-108317172 TCAGTCAGTTCCTGGGTAGGGGG - Intronic
1047823201 8:128544045-128544067 TCGCTCAATAACTGGGTGGAGGG + Intergenic
1048297014 8:133221896-133221918 TGGGTCAATTAATGGATGGATGG + Intronic
1049371946 8:142272196-142272218 TGGGTGAGTGGCTGGGTGGATGG - Intronic
1051248616 9:15136831-15136853 TGAGTCAGTTCCTGGGTGGGAGG - Intergenic
1051631081 9:19141532-19141554 TAAGTCAGTTCCTGGGTGGGAGG - Intronic
1056423914 9:86457042-86457064 TAGCTCAGTAACTGCGTGGATGG - Intergenic
1056586114 9:87928274-87928296 TTGGTAAGCCACTGGGTGGACGG - Intergenic
1056610768 9:88124669-88124691 TTGGTAAGCCACTGGGTGGACGG + Intergenic
1056682272 9:88730319-88730341 TTGGTGAGTTGGTGGGTGGATGG - Intergenic
1059487217 9:114636028-114636050 TGGGTCAGTCAGTGGGAGGAAGG + Intronic
1060306380 9:122416554-122416576 TGAGTCAGTTCCTGGGTGGGGGG + Intergenic
1061201314 9:129140071-129140093 TCTGTCAGTAACTGGGGGGATGG - Intronic
1062051979 9:134452118-134452140 TGGGTGAGTGAATGGGTGGATGG - Intergenic
1188138634 X:26521127-26521149 TCAGTCATTTCCTGGGTGGGGGG + Intergenic
1192661435 X:73046799-73046821 TCAGCCAGCTACTTGGTGGAGGG - Intergenic
1194577128 X:95627048-95627070 TGGGTCATTTTCTGGGTGGGGGG - Intergenic
1195466968 X:105190210-105190232 TGGGTCATTCACTGGGTGGGGGG + Intronic
1197439102 X:126468867-126468889 TTGGTCAGTTCCTGGGAGGTGGG - Intergenic
1202080012 Y:21074609-21074631 TCAGTCAGGTGCTGGGTAGATGG - Intergenic
1202169263 Y:22023713-22023735 AGGGCTAGTTACTGGGTGGATGG + Intergenic
1202222098 Y:22562652-22562674 AGGGCTAGTTACTGGGTGGATGG - Intergenic
1202321017 Y:23633015-23633037 AGGGCTAGTTACTGGGTGGATGG + Intergenic
1202549750 Y:26037041-26037063 AGGGCTAGTTACTGGGTGGATGG - Intergenic