ID: 901840843

View in Genome Browser
Species Human (GRCh38)
Location 1:11952992-11953014
Sequence CTGTGTCCTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5195
Summary {0: 7, 1: 285, 2: 807, 3: 1675, 4: 2421}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901840840_901840843 10 Left 901840840 1:11952959-11952981 CCTCTAACTGGTACAGACACAGC 0: 1
1: 0
2: 1
3: 14
4: 125
Right 901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG 0: 7
1: 285
2: 807
3: 1675
4: 2421
901840839_901840843 11 Left 901840839 1:11952958-11952980 CCCTCTAACTGGTACAGACACAG 0: 1
1: 0
2: 0
3: 10
4: 165
Right 901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG 0: 7
1: 285
2: 807
3: 1675
4: 2421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901840843 Original CRISPR CTGTGTCCTCAGATGGTGGA AGG Intronic
Too many off-targets to display for this crispr