ID: 901843018

View in Genome Browser
Species Human (GRCh38)
Location 1:11965518-11965540
Sequence AGCTGTCTAGGGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901843018_901843026 10 Left 901843018 1:11965518-11965540 CCATCTGCTCTCCCTAGACAGCT 0: 1
1: 1
2: 0
3: 32
4: 258
Right 901843026 1:11965551-11965573 CCACCTGCACAACGACCTCTGGG 0: 1
1: 0
2: 1
3: 4
4: 113
901843018_901843028 13 Left 901843018 1:11965518-11965540 CCATCTGCTCTCCCTAGACAGCT 0: 1
1: 1
2: 0
3: 32
4: 258
Right 901843028 1:11965554-11965576 CCTGCACAACGACCTCTGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 93
901843018_901843024 9 Left 901843018 1:11965518-11965540 CCATCTGCTCTCCCTAGACAGCT 0: 1
1: 1
2: 0
3: 32
4: 258
Right 901843024 1:11965550-11965572 CCCACCTGCACAACGACCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901843018 Original CRISPR AGCTGTCTAGGGAGAGCAGA TGG (reversed) Exonic
900421125 1:2556384-2556406 AGCTGTCCAGGCAAAGCCGAGGG - Exonic
900689373 1:3970945-3970967 ATCTGTATCAGGAGAGCAGACGG + Intergenic
901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG + Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
902286961 1:15413184-15413206 AGGGCTCTGGGGAGAGCAGAGGG + Intronic
902477978 1:16698146-16698168 AGCGGGCCAGGGAGAGCAGGAGG + Intergenic
902633473 1:17719701-17719723 AGCTGCCTGGGGGGACCAGAAGG + Intergenic
903323507 1:22556320-22556342 TGGTGTCCAGCGAGAGCAGAAGG + Intergenic
903498447 1:23788011-23788033 AGCAGTCTGGGGAGAGCATGGGG + Exonic
905907123 1:41626540-41626562 AACTGTCCAGGGAGTACAGATGG - Intronic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
906953705 1:50355040-50355062 AGCTTACCAGGGAGAACAGAAGG - Intergenic
909789120 1:79651550-79651572 AGTTGTCCTGGCAGAGCAGAAGG + Intergenic
910789644 1:91037991-91038013 AGATGTCTAAGGAGAGTATATGG - Intergenic
910967277 1:92820146-92820168 GGCTGACTAGTGAAAGCAGAGGG + Intergenic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912490800 1:110061618-110061640 AGCCTGCTAGGGAGAGCTGATGG + Intronic
914909832 1:151775979-151776001 ACCTGTTTACAGAGAGCAGATGG - Intronic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
915084635 1:153377114-153377136 ATTTGTCTTGGGTGAGCAGAGGG + Intergenic
915492479 1:156258874-156258896 AGATGCCTAGGGAGAGGGGAGGG - Intronic
915734272 1:158074918-158074940 AGCTGTGGAGGGAAAGAAGAAGG + Intronic
915739361 1:158106754-158106776 AGGAGTCGAGGGAGAGCTGATGG - Intergenic
918085454 1:181241042-181241064 TGCTGTGAGGGGAGAGCAGAGGG + Intergenic
918596723 1:186302814-186302836 GGATGTCTAGGGAGTGAAGATGG + Intronic
920415094 1:205794025-205794047 AGCTGTAAAGGGATAGCATAAGG + Intronic
920525843 1:206665623-206665645 CCCAGTCTAGGGAGACCAGAAGG - Intronic
920629469 1:207637612-207637634 ATCTGCCTAGGGAGAGCACCAGG - Intronic
920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG + Intronic
921277339 1:213532940-213532962 GGCTATCTGGGGAGAGCAGAGGG + Intergenic
921320154 1:213930909-213930931 AGCTGTGTAGGAAGTGTAGAAGG - Intergenic
922063400 1:222113057-222113079 ATCTGTCTACGAAGAGCAGAGGG - Intergenic
922976996 1:229793388-229793410 AGCTGTATAGGGTGAGGAGGAGG + Intergenic
923769971 1:236929920-236929942 AGCTGTGCAGGGCTAGCAGAGGG - Intergenic
1064976859 10:21126051-21126073 AGCTGGTTGGGGAGACCAGAAGG - Exonic
1065149256 10:22805401-22805423 AGCTGGCTAGGGAAACCACATGG + Intergenic
1066132789 10:32410303-32410325 AGCTTTGTAGAGAGAGCAAAAGG - Intergenic
1067174213 10:43931068-43931090 ATCTGCCCAGGGAGAGCAGAGGG + Intergenic
1067539443 10:47141151-47141173 AACTGTCTAGCAAGTGCAGATGG - Intergenic
1069464772 10:68628578-68628600 AGCTGTGTAGGGATAGTAAAGGG + Intronic
1069813434 10:71178990-71179012 GGCTGTCTAGGGAGGGAGGAGGG - Intergenic
1070577513 10:77690513-77690535 AGCAGGCTAGGGAGGGCAGCAGG + Intergenic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1070768887 10:79070886-79070908 AGCAGTCAGGGGAGAGGAGAAGG - Intronic
1075742387 10:124703859-124703881 AGCAGTCAGGGGAGAGCAGGCGG - Intronic
1076186016 10:128449767-128449789 AGCTGTCTCTGGAGAGCAAGTGG + Intergenic
1076463697 10:130664069-130664091 AGCTTTCATGGAAGAGCAGACGG + Intergenic
1076854364 10:133108742-133108764 AGCTGTCTTGGGATATCTGAGGG - Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078146081 11:8722654-8722676 ACCTGACTAGGGAGGCCAGAGGG - Intronic
1080112798 11:28587595-28587617 AGCTGTCTTTGGAGAGCATTTGG - Intergenic
1080360779 11:31510353-31510375 AGCTGCCTGGAGAAAGCAGAAGG - Intronic
1082011743 11:47454388-47454410 AGCTGTCTAGGACCAGCAGATGG - Intergenic
1084617244 11:70244772-70244794 AACTAGCCAGGGAGAGCAGATGG + Intergenic
1085305169 11:75481718-75481740 CCCTGTCTAGGGAGTGCACAGGG - Intronic
1085670883 11:78463908-78463930 AGCTGGCTTGGCAGAGCAGGAGG - Intronic
1086404712 11:86489736-86489758 ACCTGTGAAGGGAGAGCAGAAGG - Intronic
1089333054 11:117703399-117703421 AGCTGTCTGGGAAGGGGAGATGG - Intronic
1089649279 11:119901817-119901839 AGCTGTCCAGGGAGAGCCCCAGG - Intergenic
1089898427 11:121956037-121956059 AGCAGTCTAGGGAGAACTCAAGG - Intergenic
1089898605 11:121957693-121957715 AGCAGTCTAGGGAGAGCTCAGGG - Intergenic
1090397286 11:126427398-126427420 AAGTGTTTTGGGAGAGCAGAAGG + Intronic
1091231666 11:133991681-133991703 GGCTGTCTGCGGAGAGCAGTGGG + Intergenic
1092208924 12:6633793-6633815 AGCAGAGTAGGGAGAGCAGATGG + Intronic
1092274288 12:7047489-7047511 AGCTTTCTAGGAATAGCAGCAGG + Intronic
1093317345 12:17667363-17667385 CCCTGTCAAGGGAGATCAGATGG - Intergenic
1093404051 12:18783036-18783058 AGTTGTCTCAGGCGAGCAGAAGG - Intergenic
1093741609 12:22694856-22694878 AGCTGTCTAGTGAGAGAGAAGGG - Intergenic
1093971778 12:25382551-25382573 AGCTGTTTAGTCAGAGAAGAAGG + Intergenic
1095934103 12:47658128-47658150 AGCTGTCAGGGGAGAGGAGAGGG + Intergenic
1098260652 12:68666827-68666849 ATCTCTCTAGGGAGACCTGAGGG - Exonic
1102533110 12:113561479-113561501 AGCTGTAGAGGGAGAGGAGGGGG + Intergenic
1103177544 12:118877743-118877765 AGCTTTGTGGGGAGATCAGAGGG - Intergenic
1103267259 12:119641090-119641112 AGGTTTCTAGGAAGAGCAGCAGG + Exonic
1104746880 12:131216160-131216182 GGGTGTCTGGGGAGAGCAGCTGG - Intergenic
1104785737 12:131447023-131447045 GGGTGTCTGGGGAGAGCAGCTGG + Intergenic
1106154055 13:27135820-27135842 AGCTAGCTAGGGAGGGGAGAAGG + Intronic
1107659706 13:42626155-42626177 AGAAGTCAAAGGAGAGCAGAGGG + Intergenic
1111014355 13:82358116-82358138 TACTGTCTAGGGGGAGCAAAAGG - Intergenic
1113403938 13:110020965-110020987 AACTGTCCTGGGAAAGCAGAAGG - Intergenic
1117285048 14:54278898-54278920 ACCTGACTGGGGAAAGCAGAGGG + Intergenic
1118284159 14:64455901-64455923 AGCTCTCTATAGAGAGCAGAAGG + Intronic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1122627630 14:103092334-103092356 AGGTGCCTGTGGAGAGCAGATGG + Intergenic
1125439755 15:39689384-39689406 AGATGTCCAGGGAGGGGAGAGGG - Intronic
1125770112 15:42159580-42159602 AGGTGTTTAGGCACAGCAGAGGG - Exonic
1127450758 15:59114135-59114157 AGCAGTCAAGGGAGAGAAGCAGG + Intronic
1127968417 15:63941144-63941166 GGCTTTCCAGGCAGAGCAGATGG - Intronic
1128162587 15:65434099-65434121 AGCTGAGGAGGGAGAGCAGGAGG - Intergenic
1128471772 15:67959930-67959952 AGCTGTCATGGGAGAGTGGATGG + Intergenic
1128474758 15:67987784-67987806 AGCTGTCAAGGGAGGCCAGGAGG + Intergenic
1128708424 15:69854046-69854068 TGCAGTCTAGGCAGAGCAGCTGG - Intergenic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1129116067 15:73366105-73366127 AGAAGACTAGGGAGACCAGAGGG - Intronic
1129664015 15:77569344-77569366 AGCTGACCAGGCAGAGCAGCCGG - Intergenic
1131359167 15:91774139-91774161 AGGTGACTAGGGAAAGGAGATGG - Intergenic
1135282087 16:21160558-21160580 AGCTTTCTAGGGAGAATAAAAGG + Intronic
1137490280 16:48926641-48926663 AGGTGTCCAGATAGAGCAGAAGG + Intergenic
1137575182 16:49594885-49594907 AGATGTCTTGGGAGAGCAAGAGG + Intronic
1137745837 16:50819402-50819424 GGCTGTCCTGGGAGAGCAGGTGG - Intergenic
1138685458 16:58721378-58721400 GGCTGTGAAGGGACAGCAGAGGG + Intronic
1140480334 16:75259009-75259031 AGGTTTCTAAGGAGAGCAGGAGG - Intronic
1141324865 16:83046963-83046985 AGCTGTTTATGGAAATCAGATGG + Intronic
1143022991 17:3926240-3926262 AGCTGGCTTGGGAGCGCAAAGGG + Intronic
1143761027 17:9104515-9104537 AGCTGTGAGGGCAGAGCAGAGGG + Intronic
1144440581 17:15277514-15277536 AGCAGGCTGGGGAGAGCAGAAGG + Intergenic
1144463820 17:15480624-15480646 AGCTGGCGAGGGAGAGTAGTAGG - Intronic
1144649966 17:17001304-17001326 TGCTGGCTTGGGAGAGCAGGAGG - Intergenic
1145748214 17:27336275-27336297 AGCTGGGTAGGGAGATTAGAGGG - Intergenic
1146197161 17:30823874-30823896 AGCTATGTTGGAAGAGCAGAAGG - Intronic
1147919425 17:43907037-43907059 AGCTGCCTAGGGGGACCAGGGGG + Intronic
1149521107 17:57318888-57318910 AGCTGTTGAGGGAGAGAAGCAGG + Intronic
1150348930 17:64426730-64426752 ATCTGTCTCAGGTGAGCAGAGGG - Intergenic
1150360375 17:64527489-64527511 AGATCTGTGGGGAGAGCAGAGGG - Intronic
1150590524 17:66558437-66558459 ATCAGTGTAGGGAGAGGAGAGGG + Intronic
1151446037 17:74164724-74164746 AGCTGTCTAGGCAGAGTGGGTGG - Intergenic
1151617798 17:75225715-75225737 AGCTGCCTTGTTAGAGCAGAAGG + Exonic
1151671028 17:75571789-75571811 TGCTGGGCAGGGAGAGCAGAGGG + Intronic
1151921161 17:77156590-77156612 AGATGTCTATGAAGAGTAGAGGG + Intronic
1152403341 17:80082674-80082696 AGCTGGCCAGGCAGAGCTGAAGG + Intronic
1152800914 17:82330257-82330279 AGCAGCCTGGGGAGAGCAGCAGG - Intronic
1155074593 18:22343539-22343561 AGGTGGATGGGGAGAGCAGAGGG - Intergenic
1156558922 18:38099425-38099447 GGCTTTCTGGGGAGAACAGAAGG + Intergenic
1156687791 18:39670657-39670679 AATTGTCTAGGGAGAAAAGATGG - Intergenic
1156848817 18:41701561-41701583 ATCTTCCTAGGTAGAGCAGAGGG - Intergenic
1157415845 18:47502160-47502182 AGCTGTCTGGGGAACTCAGAAGG + Intergenic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158414165 18:57234630-57234652 AGTCTTCTGGGGAGAGCAGAAGG + Intergenic
1158658659 18:59364677-59364699 TACTGTCTTGGGAGAGCAGAAGG - Intergenic
1158787389 18:60731132-60731154 GGCTTTCTAAGGAAAGCAGATGG - Intergenic
1159878980 18:73840068-73840090 ACCTTTCTAGGGAGTGGAGAGGG - Intergenic
1160210343 18:76873443-76873465 AGCTGCCTGGAGAGAGCAGCAGG + Intronic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1165412059 19:35668140-35668162 CACTGTCAAGGGAGGGCAGATGG + Intronic
1165922055 19:39305383-39305405 AGCTGGTTGGGGAGAGGAGAGGG - Intergenic
1166863512 19:45822918-45822940 AGCTCCCCAGGGCGAGCAGAAGG - Intronic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1168634104 19:57981885-57981907 AGCTCTCTAAGGATAGCAGCAGG - Intronic
1202711998 1_KI270714v1_random:23973-23995 AGCGGGCCAGGGAGAGCAGGAGG + Intergenic
927881806 2:26694327-26694349 AGGGGACTAGGGAGAGGAGAGGG - Intronic
928088530 2:28360305-28360327 AGCTGTCTAGGGAGGTCCAATGG + Intergenic
929866476 2:45721428-45721450 AGTTGTCAGGGGAGTGCAGAAGG + Intronic
929953038 2:46431443-46431465 AGCTGACTGGGGAGAGTAAAGGG + Intronic
930190266 2:48451780-48451802 ATCTGTCTAAAGAGAGCAGAGGG - Intronic
931877256 2:66527534-66527556 AGATCTCTAGGGACAGCAAAGGG - Intronic
932842475 2:75096295-75096317 TGATGTTTAGGGAGAGCAGAGGG - Intronic
935096312 2:99947730-99947752 ATCTGACCAGGGAGATCAGACGG + Intronic
935160522 2:100525866-100525888 ACCTGTCTCAGGTGAGCAGAAGG - Intergenic
936400926 2:112163940-112163962 AGATGTCTGGGGAGGGCAGAGGG - Intronic
936505662 2:113103751-113103773 AGATGGTTGGGGAGAGCAGAGGG + Intergenic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
937077871 2:119120106-119120128 ATGTGTCAGGGGAGAGCAGAAGG + Intergenic
939699515 2:145372702-145372724 AGCTGCCTAGAGAGAGCAGCAGG - Intergenic
940216345 2:151307519-151307541 AGTTGTCCAGGGAGAGTTGATGG - Intergenic
941068390 2:160928788-160928810 AGGTGTGTAGGGAGAGGAAAAGG + Intergenic
941929129 2:170923667-170923689 AGCTGTCTGGTGCCAGCAGAGGG + Intergenic
942189238 2:173454667-173454689 AGCTGTCTGGGGAGAAGGGAGGG - Intergenic
944146384 2:196511792-196511814 AGGTTTCTAGAGAGACCAGAAGG + Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945506521 2:210648000-210648022 AGCTGTCTTGGATGAGCTGAAGG + Exonic
945934218 2:215886706-215886728 ATCTGTCTCAGGTGAGCAGAGGG - Intergenic
947387519 2:229606397-229606419 GTCTGTTTAGAGAGAGCAGAAGG + Intronic
947488006 2:230570203-230570225 TGATGTCTAGGGAGAAGAGAAGG - Intergenic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
947967543 2:234294202-234294224 AGCTGTGTGGGCAGAGAAGAAGG - Intergenic
948436366 2:237956542-237956564 AGCAGACTAGGGAGGGCTGATGG + Intergenic
1169092166 20:2867589-2867611 GGCTAGATAGGGAGAGCAGAGGG - Intronic
1171044615 20:21798182-21798204 TGCTGTGGAGGGAGAGCAGGTGG + Intergenic
1171108915 20:22462600-22462622 ACCTGTATGGGGAGAGCAGAAGG - Intergenic
1171191601 20:23163059-23163081 AGCTGTCTGAGGAGAGCAGGAGG + Intergenic
1171237528 20:23539531-23539553 AGCTGCCCAGGGAGGTCAGAGGG + Intergenic
1173205000 20:40985916-40985938 CCCTCTCTTGGGAGAGCAGAGGG - Intergenic
1174329951 20:49810207-49810229 AGCTGTCTAGGCAGAGACAATGG + Intergenic
1174944481 20:54970258-54970280 AGTTGACAAGGCAGAGCAGAAGG + Intergenic
1175229028 20:57461838-57461860 TGCTGTCTAGGGAGGGGAGGAGG - Intergenic
1175738844 20:61406431-61406453 GGTGGTCCAGGGAGAGCAGATGG - Intronic
1175738891 20:61406669-61406691 GGTGGTCCAGGGAGAGCAGATGG - Intronic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1177598118 21:23273266-23273288 AGCTGTCTAGGGACTGCCAAGGG + Intergenic
1178610845 21:34078156-34078178 AGCTGTTTAGGGAGGGCCCATGG - Intronic
1179080662 21:38167678-38167700 AGCTGTCTTCTGGGAGCAGAAGG - Intronic
1179244012 21:39614672-39614694 AGCTGTCCAGGGACAGAGGAGGG - Intronic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1180113831 21:45682733-45682755 AGCAGGCTAGGGGGAACAGAAGG + Intronic
1181515325 22:23407803-23407825 ATCTGTCTCAGGTGAGCAGAGGG + Intergenic
1182172579 22:28247805-28247827 AGCTTTCTAGAGATAACAGAAGG + Intronic
1183034331 22:35129671-35129693 AGCTGGGAAGGGAGAGGAGAAGG + Intergenic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1184998756 22:48228845-48228867 TGCTGGCTTGGGAGAGAAGACGG + Intergenic
949677618 3:6474905-6474927 AGCTATCATGTGAGAGCAGAAGG + Intergenic
950402691 3:12782075-12782097 AGGTGACTAGGTAAAGCAGAGGG + Intergenic
951501179 3:23389437-23389459 AGATGTCTTGGGAGGGAAGACGG - Intronic
953576616 3:44117765-44117787 AGCTGACTGGGGCCAGCAGATGG - Intergenic
953610765 3:44445585-44445607 AGCTCTCTAGGGAGAGTTGCAGG - Exonic
953921569 3:46955493-46955515 GGCTGTCCAGGGAGAGAAGAGGG + Intronic
954193627 3:48982875-48982897 AACTGTATAGGCAGAGCAGGAGG - Exonic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
959293372 3:104503010-104503032 AGCTGTCTAGCGAGGGCATCCGG + Intergenic
959533430 3:107459130-107459152 AGCTGTCTAGGGAGACAGTATGG + Intergenic
961107049 3:124250957-124250979 AGCTGGCTAGGGAGAGAAGGTGG - Intronic
967457887 3:189710809-189710831 AGCTGTGTAAGAAGAGCAGGAGG - Intronic
968151299 3:196338630-196338652 TGCTGCCTGGGGAGAGCGGAGGG - Intergenic
968280608 3:197474045-197474067 AGTTGTCAAGGGAGAGAAGGAGG - Intergenic
970235977 4:13958335-13958357 TGCTGTCTGGGGGCAGCAGATGG - Intergenic
974093488 4:57336691-57336713 TGCTTTCTGGGGAGTGCAGACGG + Intergenic
977349006 4:95856653-95856675 ATTTGTCTCAGGAGAGCAGAGGG + Intergenic
977848133 4:101790760-101790782 AGCGGGCTGGGGAGAGCCGAGGG + Exonic
979666201 4:123313484-123313506 AACGGTCAAGGGAGGGCAGAGGG - Intronic
982932213 4:161422942-161422964 AGCTGTTTATGGAGACCACAAGG + Intronic
984924767 4:184797042-184797064 AGCTGTCCAGGAAGGGCAGCTGG - Intronic
984984407 4:185314008-185314030 TGTTGTCTAGGCAGAGCAGGAGG + Intronic
986683109 5:10251082-10251104 AGCATTCTAGGGAGAGGAAACGG + Intronic
986689337 5:10301445-10301467 CGCTGTATTGTGAGAGCAGAGGG - Intronic
987095499 5:14545863-14545885 TTCAGCCTAGGGAGAGCAGAAGG + Intergenic
993378365 5:87176657-87176679 AGGTGTCAAGGGACAGCAAAGGG - Intergenic
993851136 5:93010780-93010802 AGGAGTCCAGGCAGAGCAGAAGG - Intergenic
994017062 5:94979391-94979413 AGCTGTATACGGTGATCAGATGG + Intronic
994441972 5:99818930-99818952 AGCTGTCTAGGAGTACCAGATGG - Intergenic
996491619 5:124104923-124104945 GGATGTCAATGGAGAGCAGATGG + Intergenic
996700224 5:126443589-126443611 ATCTCTGTGGGGAGAGCAGAAGG - Intronic
996866762 5:128132252-128132274 AGGTGTCCTGGGAGAGGAGATGG + Intronic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998503677 5:142654872-142654894 AGCAGGCAGGGGAGAGCAGAGGG + Intronic
998923737 5:147099738-147099760 AGCTGTCTGGGTAGAGGAGCTGG + Intergenic
1002704161 5:181148974-181148996 AGAGCTCTGGGGAGAGCAGAAGG + Intergenic
1003145400 6:3505985-3506007 AGGTCTTTAGGGAGAGGAGATGG + Intergenic
1003153194 6:3570097-3570119 AGATGTGGAGGGAGAGGAGAGGG - Intergenic
1004076203 6:12346316-12346338 AGCTGTTTAGGGAGAGGTCATGG - Intergenic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1005845988 6:29779045-29779067 AGCTGTCAAGGTAGAGAGGAGGG - Intergenic
1006302004 6:33198689-33198711 AGGTGTCTTGGGAAAGCAGATGG + Intronic
1006329775 6:33382086-33382108 AGCTAACCTGGGAGAGCAGAAGG + Intergenic
1008525969 6:52407250-52407272 TGCAGTGTAGGGAGAGGAGATGG + Exonic
1010175007 6:73017885-73017907 AGCTCTCAGGGGAGACCAGAAGG + Intronic
1015973373 6:138764894-138764916 AGCTCTCTAGCAAGTGCAGATGG - Intronic
1017706807 6:157131409-157131431 AGGTGTCGAGGGAGGGCTGAGGG + Intronic
1017907532 6:158767330-158767352 AGCTGTCTAGTGAGGGCATCCGG - Exonic
1019813830 7:3184672-3184694 AGCTGTCCCGAGAGACCAGAAGG - Intergenic
1021932460 7:25595335-25595357 AGCTCTCTTGGGATAGCACAGGG - Intergenic
1022590111 7:31653444-31653466 ATTTGTCTCGGGGGAGCAGAGGG + Intronic
1023594302 7:41812632-41812654 AGCTCTCTAGAGAGAGAAGCAGG + Intergenic
1023806917 7:43878874-43878896 AACTGTCTGAGGAGAGCAGCAGG + Exonic
1024037525 7:45521243-45521265 TCCTGTCTTGGGAGAGGAGAAGG + Intergenic
1024473749 7:49789726-49789748 ACCTGTTTGGGGAGAGAAGAAGG - Intronic
1026253960 7:68694734-68694756 AGTTGTCTGGTGAGAGCAGAGGG - Intergenic
1029457185 7:100677320-100677342 AACGGTGTAGGGAGAGCAGAAGG - Intronic
1031018155 7:116597764-116597786 CTCTGTCAAGGAAGAGCAGAAGG + Intergenic
1031102261 7:117496037-117496059 AGTTGTCTAGGGCGAGCAGGGGG - Intronic
1031278343 7:119761763-119761785 TGCTCTCTAGAGAGAGCAGAAGG - Intergenic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1033646445 7:143308467-143308489 GGCAGTCTAGGAAGAGCAGAAGG + Intergenic
1034579046 7:152026556-152026578 ATCTGTCTCAGGTGAGCAGAAGG - Intronic
1036272883 8:7323520-7323542 AGAGGTCATGGGAGAGCAGATGG + Intergenic
1036348467 8:7986828-7986850 AGAGGTCATGGGAGAGCAGATGG - Intergenic
1036843737 8:12147293-12147315 AGAGGTCATGGGAGAGCAGATGG - Intergenic
1037506823 8:19538894-19538916 AGCGGTCCAGGCAGAGCAAATGG - Intronic
1037602798 8:20412171-20412193 AGGTGTCTAGTGAGAGAAAAAGG - Intergenic
1037692376 8:21192971-21192993 ACCTGTCTAGGTTCAGCAGAAGG - Intergenic
1038135079 8:24776753-24776775 GGCTTTCTAGGGAGAGAAAAGGG - Intergenic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1041173251 8:55166985-55167007 AGCTTTCAAGGGAGAGAGGATGG + Intronic
1042560327 8:70069164-70069186 AGCTGTCTGGGGGGACCAGGAGG + Exonic
1045319514 8:101071310-101071332 AGCTGTCTAGATTGAGCTGAAGG + Intergenic
1045401059 8:101818398-101818420 TGCTGTCTTAGGAGAGCACACGG + Intronic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1048354077 8:133639290-133639312 TGCTGTCTAGAGAGAATAGAGGG + Intergenic
1049997784 9:1047837-1047859 AGATGTCTGGAGAGAGCAGTGGG + Intergenic
1052956348 9:34255770-34255792 TGCAGTCTTGGGAGAGCAGCTGG + Exonic
1055305733 9:74927456-74927478 TGTTGTCGGGGGAGAGCAGAGGG - Intergenic
1055867110 9:80827996-80828018 AACAGCCTAGGGAGAGCTGAAGG - Intergenic
1056090838 9:83204057-83204079 AGTCCTCCAGGGAGAGCAGATGG + Intergenic
1056380828 9:86055770-86055792 GGCTGTCCAGGGATAGGAGAGGG + Intronic
1056741271 9:89257488-89257510 AGCTGACTATGGAGAGTAAATGG - Intergenic
1058257302 9:102783388-102783410 AGGTCTCTAGGGAGACCAAAAGG + Intergenic
1059693664 9:116710249-116710271 AGCTTTCTAGGGAGAGCAGAGGG - Intronic
1060827958 9:126697094-126697116 AGCTGTATGGGGACACCAGAAGG + Exonic
1061110902 9:128570282-128570304 AGCTGTCTAAACAGGGCAGAGGG - Intronic
1061710850 9:132486835-132486857 AGCTGTCGAGGGGGAGGGGAGGG + Intronic
1061871529 9:133523336-133523358 GGCTGTCTGGGGAGAGGAGGTGG + Intronic
1062121889 9:134838345-134838367 AGGTGTGAAGGGAGCGCAGAGGG + Intronic
1062196306 9:135276103-135276125 AGCTGTCCAGGGAGAGAGGATGG - Intergenic
1062523453 9:136969076-136969098 AGCTGTCGAGGGGAGGCAGATGG + Intergenic
1185953103 X:4458192-4458214 AACTCTCGAGGGAGAGCAGAGGG - Intergenic
1186518052 X:10181509-10181531 AGCTTTCAAGGCAGAGGAGAAGG + Intronic
1187283585 X:17881917-17881939 AGATATCTTGTGAGAGCAGAGGG - Intergenic
1187377815 X:18772277-18772299 TGCTGTCTAGGGGTGGCAGAGGG + Intronic
1189427214 X:40912295-40912317 AGCTCCCTAGGGAGAACTGAAGG + Intergenic
1191728461 X:64306893-64306915 AGTTGTACAGGGAGAGGAGAAGG - Intronic
1192546740 X:72020596-72020618 AGCTTTCTAGGGAGGGGGGAAGG + Intergenic
1200285940 X:154822442-154822464 GGATGTGAAGGGAGAGCAGATGG - Intergenic
1201739512 Y:17308417-17308439 AACTCTCAAGGGAGAGCAGAGGG - Intergenic