ID: 901843244

View in Genome Browser
Species Human (GRCh38)
Location 1:11966491-11966513
Sequence GGGCGGCGGGATGGGAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1342
Summary {0: 1, 1: 0, 2: 8, 3: 128, 4: 1205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901843244 Original CRISPR GGGCGGCGGGATGGGAGTGG GGG Intronic
900113621 1:1019821-1019843 GGGCGGGGAGAGGAGAGTGGGGG - Intergenic
900242917 1:1625460-1625482 GGGCGGAGGGCTGGGAGGGCAGG - Intronic
900268978 1:1777607-1777629 GGGAGGAGGGATGGGAGGGTGGG + Intronic
900307695 1:2019204-2019226 GGGGGGCGGGATGGGGCGGGGGG + Intergenic
900320641 1:2081810-2081832 GGGGGGCGGGGCGGCAGTGGTGG - Intronic
900486091 1:2923537-2923559 GGGAAGGGGGAAGGGAGTGGAGG - Intergenic
900502332 1:3012599-3012621 AGGCGGCGGGGTGGGGGCGGTGG - Intergenic
900586737 1:3436325-3436347 AAACGGCGGGATGGGACTGGGGG - Exonic
900637744 1:3674266-3674288 GGGAAGCGGGAGGGGAGGGGAGG - Intronic
900703133 1:4060327-4060349 GGGAGGCGGGAGAGGGGTGGAGG + Intergenic
900794761 1:4701185-4701207 GGGAAAGGGGATGGGAGTGGAGG + Intronic
900980364 1:6042831-6042853 GGGGGGGGGGTGGGGAGTGGGGG - Intronic
901163468 1:7198321-7198343 GGTCGGGGGTAGGGGAGTGGGGG - Intronic
901179993 1:7335147-7335169 GGGGGGGGGGGTGGGGGTGGGGG + Intronic
901251508 1:7783714-7783736 GGGGGGGCGGATGGGAGCGGGGG - Intergenic
901630285 1:10644665-10644687 GGGCGGCTGTCTGGGGGTGGAGG + Intronic
901786238 1:11626590-11626612 GGGCGTTGGGATGGGAGGGATGG - Intergenic
901843205 1:11966405-11966427 GGACAGCAGGATGGGAGTTGGGG + Intronic
901843214 1:11966426-11966448 GGGTGGAGGGATGGGAGTTGGGG + Intronic
901843223 1:11966448-11966470 GGGCGGCAGGATGGGAGTTGGGG + Intronic
901843233 1:11966469-11966491 GGGTGGCGGGATGGGAATGGGGG + Intronic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
901843256 1:11966512-11966534 GGGTGGTGGGATGGGGGTGGGGG + Intronic
902217175 1:14941544-14941566 GGGGGGTGGGATGGGGGTGTGGG + Intronic
902242006 1:15095596-15095618 GTGGGGCGGGGTGGGGGTGGGGG - Intronic
902292984 1:15447148-15447170 GTGCTGCGGGGTGGGGGTGGGGG - Intronic
902842865 1:19086332-19086354 GGGCGGGGGGGCGGGGGTGGGGG + Intronic
903171755 1:21558717-21558739 GGGCTGAGGGATTGGGGTGGTGG + Intronic
903190725 1:21654088-21654110 GGGGGTGGGGGTGGGAGTGGGGG + Intronic
903281213 1:22251030-22251052 GACCGGCGGGAGGGGAGGGGAGG - Intergenic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
903651759 1:24926925-24926947 GGAAGGCGGGACGGGGGTGGGGG - Intronic
904257076 1:29260613-29260635 TGGGGGCGCGATGGGAGTTGGGG - Exonic
904795330 1:33052674-33052696 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
904837780 1:33349971-33349993 GGGCCGCGGGAGGGGCGGGGCGG + Intronic
904944241 1:34187767-34187789 GGGCGGCGGGGGGGGGGGGGTGG - Intronic
905628989 1:39508411-39508433 GGGCCGTGGGATAGGAGTGGCGG - Intronic
906076920 1:43058652-43058674 GGGCGGCAGGGAGGCAGTGGTGG + Intergenic
906083123 1:43107487-43107509 GGGCGGGGGGCAGGGGGTGGTGG + Intergenic
906117834 1:43367638-43367660 GGGGGGAGGGAGGGGAGAGGAGG + Exonic
906128384 1:43441614-43441636 GGGTTGAGGGATGGGAGGGGAGG - Intronic
906208018 1:43997319-43997341 GGGGGGAGGGGTGGGAGTGGAGG - Intronic
906487189 1:46241916-46241938 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
906488284 1:46248027-46248049 GCGGGGCGGGGTGGGATTGGGGG - Exonic
906546035 1:46620098-46620120 GGGGGGCAGGGTGGGAGTGGGGG - Intergenic
906633126 1:47389146-47389168 GGGAGGAGGGATGGGACTTGTGG - Intergenic
906682503 1:47738939-47738961 GGGTGGGGGGGTGGGGGTGGTGG + Intergenic
906742027 1:48192712-48192734 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
907414079 1:54302037-54302059 GGGCGGCTGGGTGGGGGTGGGGG + Intronic
907798297 1:57739466-57739488 GGGCGAGGGGAGGGGAGGGGAGG - Intronic
908214159 1:61933808-61933830 GGGTTGGGGGATGGGAGTGCTGG - Intronic
908258594 1:62321785-62321807 GGGAGGTGGGGGGGGAGTGGGGG - Intergenic
910288493 1:85578842-85578864 GGGGGGCGGGAGGGGGGAGGAGG - Intergenic
911224131 1:95285791-95285813 GTGCGGGGGGTTGGGAGAGGAGG + Intergenic
911226321 1:95309240-95309262 GGAGGGAGGGATGGGAATGGGGG + Intergenic
911408532 1:97471875-97471897 GGGGGACGGGATGGGCGTGGTGG - Intronic
911437236 1:97876879-97876901 GGTGGGAAGGATGGGAGTGGAGG - Intronic
911995219 1:104758078-104758100 GGGAGGGGGGATGGGGGAGGGGG + Intergenic
911995240 1:104758113-104758135 GGGTGGGGGGATGGGGGTGGGGG + Intergenic
912384384 1:109263976-109263998 GGGCAGCGGGATGGGTTTGATGG + Intronic
912845162 1:113070151-113070173 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
912965169 1:114230857-114230879 GGAAGGAGGGATGGGAGGGGAGG + Intergenic
913939237 1:125086694-125086716 CGGCGGCGGCAGGGGGGTGGGGG + Intergenic
914043953 1:144076721-144076743 AGGCGGCGGGGGGGGAGGGGGGG - Intergenic
914917314 1:151826547-151826569 GAGCGTGGGCATGGGAGTGGTGG - Intronic
915302046 1:154957252-154957274 GAGCAGCGGGGTGGGGGTGGGGG + Exonic
915326717 1:155084665-155084687 GGGAGGAGGGATGGGAGGGATGG - Intronic
915339309 1:155167555-155167577 GGGAGGGGGGAAGGGAGTGGCGG - Intergenic
915344997 1:155192946-155192968 GGCGGGCGGGCGGGGAGTGGGGG - Intergenic
915381064 1:155441299-155441321 CGGGGCCGGGGTGGGAGTGGGGG - Intronic
915530472 1:156499986-156500008 GGGCGGCGGGAGGGTGGAGGCGG - Intronic
915531004 1:156502018-156502040 GGGAGGCGGGAGGGGAGGCGAGG - Intergenic
915953449 1:160205300-160205322 GGGCGGGGGGCGGGGAATGGCGG - Intergenic
915978901 1:160408152-160408174 GGGAGCTGGGATGGGGGTGGGGG + Intronic
916006860 1:160670105-160670127 GGGCGGGGGGCGGGGTGTGGTGG - Intergenic
917345268 1:174022442-174022464 GGGCGGGCGGAGGGGAGGGGCGG + Intergenic
917951235 1:180039108-180039130 TTGCGGCGGGTTGGGCGTGGTGG + Intronic
918093659 1:181317611-181317633 GGGCGGCGGGCGGGGGGAGGGGG - Intergenic
919805299 1:201377780-201377802 GGGCAGGGGGATGGCGGTGGGGG + Intronic
919990037 1:202703266-202703288 CGGCGGAGGGAGGGGAGCGGTGG - Intronic
920174736 1:204093508-204093530 AGGCGGTGGCATGGGTGTGGGGG + Intronic
920293954 1:204944449-204944471 GGGCAGAGGGGTGGGAGGGGAGG + Intronic
920333662 1:205229542-205229564 GGGCGGGGGGGGGGGGGTGGTGG + Intronic
920382108 1:205541143-205541165 GGGCTGAGGAAGGGGAGTGGAGG - Intergenic
920434557 1:205939622-205939644 GGGAAGGGGGATGGGAGTGGTGG + Intronic
920844187 1:209579691-209579713 GCGTGGTCGGATGGGAGTGGTGG + Intergenic
920912534 1:210232515-210232537 GGGCACCGGGAGGGGAGGGGAGG + Intergenic
922427690 1:225514774-225514796 GGCCCGGTGGATGGGAGTGGAGG + Exonic
922496540 1:226062334-226062356 GGGCGCCCGGAGGGAAGTGGGGG - Intronic
922539874 1:226410514-226410536 GGGGGGAGGGGTGGGAGGGGAGG + Intergenic
922642951 1:227253684-227253706 GGGAGGAGAGATGGGAGAGGGGG + Intronic
922757658 1:228105497-228105519 GGGTGGCGGTCAGGGAGTGGAGG + Intergenic
922818842 1:228470471-228470493 GTGGGGCGGGTTGGGAGGGGAGG + Intergenic
923309858 1:232725342-232725364 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
923309917 1:232725429-232725451 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
923534434 1:234838188-234838210 GGGGGGCGGGGTAGGAGAGGAGG + Intergenic
924436846 1:244049351-244049373 GGGCGGCGGGCTGGGGGAGGGGG + Intronic
924443375 1:244105167-244105189 GGGCTTCCGGATGGAAGTGGCGG - Intergenic
924728244 1:246689805-246689827 GGGCGCCGGGCTGGGCGGGGAGG - Intergenic
1062831449 10:608443-608465 GTGTGGGGGGATGGGTGTGGGGG - Intronic
1063116516 10:3075596-3075618 GGGCAGGGGGCCGGGAGTGGGGG + Intronic
1063121710 10:3109354-3109376 GGCCAGCCGCATGGGAGTGGAGG + Exonic
1063592942 10:7409954-7409976 GGGCGGTGGGAAGGGGCTGGAGG - Intronic
1063960419 10:11301519-11301541 GGGCAGCGGGAGCGGGGTGGGGG - Intronic
1064231800 10:13535848-13535870 GGGCGGCGGGGGGAGGGTGGGGG - Intergenic
1064552777 10:16520443-16520465 GGGCGGCGGGGAGGGCGGGGAGG - Intronic
1064996611 10:21301923-21301945 TGGAGGGGGGATGGGAGTGGAGG - Intergenic
1065100444 10:22325804-22325826 GGGGGCCGGGATGCGAGGGGCGG - Intronic
1065367323 10:24949368-24949390 GGGCAGGTGGCTGGGAGTGGTGG - Intronic
1065501964 10:26391871-26391893 GGGGGGCGGGAAGGGGCTGGTGG - Intergenic
1065590351 10:27256758-27256780 GGGGGGCGGGGCGGGAGCGGGGG - Intergenic
1065590365 10:27256782-27256804 GGGGGGCGGGGCGGGAGCGGGGG - Intergenic
1065590379 10:27256806-27256828 GGGGGGCGGGGCGGGAGCGGGGG - Intergenic
1066198973 10:33127969-33127991 GGGAGGGGGGAAGGGAGGGGAGG - Intergenic
1066370568 10:34815331-34815353 GGACGGCGGGAGGGGAGGGGAGG + Intergenic
1066464562 10:35640935-35640957 GCGCGGCGGGCTGGGCGCGGCGG + Exonic
1067733230 10:48828932-48828954 GGGGGGCGGGGAGGGGGTGGTGG + Intronic
1067760062 10:49038446-49038468 GGCTGGCTGGGTGGGAGTGGGGG + Intronic
1068080841 10:52315152-52315174 GGGCGGGGGGTTGGGGGGGGTGG + Intronic
1069111800 10:64456737-64456759 GGGAGGGGGGATGGGGGAGGGGG - Intergenic
1069740934 10:70686856-70686878 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
1069879540 10:71583238-71583260 GGGAGGCGGGGTGGGGGCGGGGG + Intronic
1070572361 10:77649957-77649979 GGGTGGGGGGGTGGGAGGGGGGG + Intergenic
1070771449 10:79084860-79084882 GGGTGGTGGGGTGGGGGTGGGGG + Intronic
1070800548 10:79242551-79242573 GGCCGGGGGGAGGGGAGGGGAGG - Intronic
1070800666 10:79242978-79243000 GGGCGGCGGGCTGGGGGGCGGGG + Intronic
1070812688 10:79306285-79306307 GGGAGGCGGGAGGGGATAGGGGG - Exonic
1070813946 10:79311810-79311832 GGGCTGCTGGATGGGGCTGGCGG + Intronic
1070889935 10:79935745-79935767 GGGAAGAGGGATGGGACTGGGGG + Intergenic
1070945054 10:80383838-80383860 AGGGGCTGGGATGGGAGTGGAGG - Intergenic
1071086788 10:81875137-81875159 GGGCGGCGGGCGGGGAGGAGAGG - Intergenic
1071197364 10:83176367-83176389 GGGGGGTGGGGTAGGAGTGGTGG + Intergenic
1071527521 10:86366842-86366864 GGGAGGCGGGCAGGGAGGGGAGG - Intergenic
1071530540 10:86387940-86387962 GGGGGGAGGGTTGGGGGTGGTGG - Intergenic
1071613913 10:87056981-87057003 TGGCGGGGGGAGGGGGGTGGCGG + Intronic
1072116974 10:92376025-92376047 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1072117133 10:92376384-92376406 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1072149598 10:92674516-92674538 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1072591257 10:96830966-96830988 GCGGGGTGGGCTGGGAGTGGTGG + Intergenic
1072949596 10:99838759-99838781 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
1072949863 10:99839342-99839364 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
1073046568 10:100642557-100642579 GGGCAGGGGGATGTGAGGGGAGG + Intergenic
1073156818 10:101354075-101354097 GGGCGGGGGGAAGGAAGAGGAGG + Exonic
1073163315 10:101420493-101420515 GGGTGGGGGGATGGCAGTGAGGG - Intronic
1073225657 10:101916358-101916380 GGGAGCTGGGATGGGGGTGGGGG - Intronic
1073325810 10:102643581-102643603 GGGCCGGGGGAGGGGAGGGGAGG + Intergenic
1073578247 10:104642177-104642199 GGCCGCCGGGAGGGGAGTGGAGG + Intronic
1073977712 10:109119476-109119498 GGGGGAGGGGAAGGGAGTGGAGG + Intergenic
1074046936 10:109848057-109848079 GGGCGGTGGGGTGGGTGTGGGGG - Intergenic
1074086133 10:110210039-110210061 GGGCGGCGGGGTGGGGGGTGGGG - Intronic
1074104195 10:110376464-110376486 CGGAGGCAGGAGGGGAGTGGAGG - Intergenic
1074165567 10:110871653-110871675 GCGTGGCGGGATGGGAGCGTTGG - Intergenic
1074326316 10:112455200-112455222 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1075016046 10:118910575-118910597 GGGGGGGGGGATGGGGGTGGGGG + Intergenic
1075092367 10:119450965-119450987 GGGGGGCGGGATGACTGTGGGGG - Intronic
1075363480 10:121861594-121861616 GGGTGGCGGGAGGGGGGAGGGGG + Intronic
1075626900 10:123970130-123970152 GGTGGGTGGGATGTGAGTGGGGG + Intergenic
1075679338 10:124321386-124321408 GGGCGGAGGGGTGGGGGTGGTGG - Intergenic
1075857334 10:125640953-125640975 GGGGGGAGAGATGGGTGTGGGGG - Intronic
1076022582 10:127086220-127086242 GGGTGGGGGGATGGGAGGTGGGG - Intronic
1076149450 10:128150372-128150394 GCGCAGCGGGACGGGATTGGTGG + Intergenic
1076312495 10:129518478-129518500 GGGCAGGGGGAAGGGAGGGGAGG - Intronic
1076312508 10:129518503-129518525 GGGCAGGGGGAAGGGAGGGGAGG - Intronic
1076354163 10:129840179-129840201 AGGGGTGGGGATGGGAGTGGGGG - Intronic
1076652652 10:132000540-132000562 GGGTGGGGGGATGGGTGGGGGGG - Intergenic
1076659720 10:132047671-132047693 GGGGGGCGGGACGGGAGGGTGGG - Intergenic
1076674804 10:132142304-132142326 GGGAGGCGGGGTGGTAGTGGTGG + Intronic
1076686251 10:132199685-132199707 GGGGGGCGGGGTGGTGGTGGTGG + Intronic
1076815395 10:132912113-132912135 GGGTGGGGGGGTGGGGGTGGAGG - Intronic
1076948546 10:133666873-133666895 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076949530 10:133670172-133670194 GGCCGGCGGGGTGGTGGTGGTGG - Intronic
1076950514 10:133673471-133673493 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076951504 10:133676781-133676803 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076952494 10:133680091-133680113 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076953477 10:133683390-133683412 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076955450 10:133743052-133743074 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076956440 10:133746362-133746384 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076957428 10:133749671-133749693 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076958412 10:133752970-133752992 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076959401 10:133756280-133756302 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1076960385 10:133759579-133759601 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
1077065543 11:639577-639599 GGGCGGCGGGCGGGGCGCGGGGG - Intronic
1077089354 11:771424-771446 GGGCTGCGGGAGCGGGGTGGGGG + Exonic
1077156556 11:1094643-1094665 GGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077156563 11:1094664-1094686 GGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077156632 11:1094919-1094941 TGGTGGAGGGCTGGGAGTGGTGG - Intergenic
1077201399 11:1309312-1309334 GGCCGGCCGGAGGGGAGCGGCGG - Intronic
1077204691 11:1336752-1336774 GGGCGGGGGGCGGGGCGTGGAGG + Intergenic
1077210670 11:1369719-1369741 GGGTGGCTGGGTGGGAGAGGCGG + Intergenic
1077277497 11:1721048-1721070 GTGGGGCTGGAAGGGAGTGGCGG + Intergenic
1077308864 11:1879736-1879758 GGGAGGCAGGCTGGGAGAGGGGG + Intronic
1077388419 11:2286964-2286986 GGGAGGGGAGATGGGAGGGGAGG - Intergenic
1077460944 11:2709224-2709246 GGGCTGGGGGGTGGGGGTGGGGG - Intronic
1077548700 11:3189396-3189418 GGGAGGCGGGTGGGGGGTGGGGG + Intergenic
1077648115 11:3944473-3944495 GGGAAGTGGGATGGGAGTGATGG + Intronic
1077923076 11:6655827-6655849 GGGCGGGGGGAGGGGAGGGGAGG - Exonic
1078340852 11:10497144-10497166 GTGTGGGGGGATGGGGGTGGTGG + Intronic
1078891363 11:15561189-15561211 GGGGGGCGGGGAGGGGGTGGTGG - Intergenic
1078987854 11:16612580-16612602 GGGGGCGGGGTTGGGAGTGGGGG + Intronic
1079095818 11:17509545-17509567 CGGGGGAGGGATGGGAATGGGGG + Exonic
1079353643 11:19713491-19713513 GGGTGCCGGGATGGGAATGGGGG - Intronic
1079377744 11:19908853-19908875 GGGCTGTGGGGTGGGAGTAGAGG + Intronic
1079380433 11:19933275-19933297 GGGCTGCGGGATGGCCGAGGAGG - Exonic
1080019590 11:27546045-27546067 GGGCTGGTGGGTGGGAGTGGAGG + Intergenic
1080110046 11:28556496-28556518 GGGGGTGGGGGTGGGAGTGGGGG + Intergenic
1080475373 11:32585082-32585104 GGGCGGGGGGAGGAGAGAGGGGG - Intronic
1080779816 11:35419621-35419643 GGGGGGAGGGATGGCAGAGGAGG - Intronic
1081728978 11:45355277-45355299 GGGAGGGGGGATGGGAGGAGGGG + Intergenic
1081809022 11:45905047-45905069 TGGGGGTGGGATGGCAGTGGAGG + Intronic
1081854856 11:46296735-46296757 GGCAGGCGGGGTGGGGGTGGAGG - Intronic
1081909919 11:46694240-46694262 GGGAGGTAGGATGGGGGTGGGGG - Intronic
1082140063 11:48598752-48598774 GGGCGGGGGGAGGGGGGAGGGGG - Intergenic
1082795636 11:57376393-57376415 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082795671 11:57376480-57376502 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082807140 11:57458599-57458621 CGGCGGCGGGGAGGGAGTGTTGG - Intergenic
1083154684 11:60815518-60815540 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1083267918 11:61555411-61555433 GGGCTGCGGGCTGGGCGGGGCGG + Intronic
1083365653 11:62140170-62140192 CGGCGGCAGGGTGGGAATGGGGG - Intronic
1083889324 11:65588153-65588175 GGGAGGCGGGAAGAGTGTGGGGG + Intronic
1083992888 11:66257773-66257795 GGCCGGCGGGATGGAGGCGGCGG + Intronic
1083997349 11:66278859-66278881 AGGCGGCTGGATGGTGGTGGGGG - Intronic
1084049741 11:66592012-66592034 AAGGGGCGAGATGGGAGTGGAGG + Exonic
1084118579 11:67056130-67056152 AGGCAGCGGGACGGGAGTAGGGG - Intergenic
1084165459 11:67373090-67373112 GGGCGGCGGGAGGCGAGGGGAGG - Intronic
1084364269 11:68687455-68687477 GGGAGACAGGATGGGGGTGGGGG - Intronic
1084429799 11:69104837-69104859 GGGCGGTGGGGAGTGAGTGGCGG + Intergenic
1084488303 11:69463878-69463900 GGGCGGGGGGATGGCTCTGGGGG - Intergenic
1084694838 11:70746944-70746966 GGGTGGAGGGAGGGGGGTGGAGG - Intronic
1084694875 11:70747026-70747048 GGGTGGAGGGAGGGGAGTGCAGG - Intronic
1084729504 11:71064413-71064435 GGGAGGCAGGAAGGCAGTGGTGG + Intronic
1084864042 11:72041319-72041341 GGGCGGCGGGTTGAGGGTGAAGG + Intronic
1084916974 11:72435804-72435826 AGGGGGCGGGATGGGAGTGCAGG - Intergenic
1084924707 11:72502472-72502494 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1085245857 11:75099679-75099701 GGAGGGAGGGAAGGGAGTGGGGG + Intergenic
1085281841 11:75336052-75336074 GGGCTGCGAGATGGGAGAGCAGG - Intronic
1085284637 11:75351749-75351771 GGGCGGCGGGCGGGGACCGGGGG - Intergenic
1085344504 11:75759355-75759377 TGGCGGTGGGAGAGGAGTGGAGG + Intergenic
1085416341 11:76321465-76321487 GGGGGGCGGGGGGGGACTGGGGG - Intergenic
1088539905 11:110902725-110902747 GGGCGGTGGGGTAGGATTGGGGG + Intergenic
1088645298 11:111912664-111912686 GGGGGAGGGGCTGGGAGTGGGGG - Exonic
1088723189 11:112612417-112612439 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1088777958 11:113104213-113104235 GGGGGGCGGGGTGGTGGTGGCGG + Intronic
1088858043 11:113773714-113773736 GGCCGGCGGGACGGGAGCTGCGG - Exonic
1089171000 11:116511442-116511464 GGGCATCGGGGTGGGGGTGGGGG + Intergenic
1089192350 11:116662089-116662111 GGGCAGGGGGATGTCAGTGGAGG + Intergenic
1089230922 11:116975360-116975382 TGGTGGAGGGATAGGAGTGGGGG - Intronic
1089270801 11:117300190-117300212 GGTGAGAGGGATGGGAGTGGAGG - Intronic
1089297961 11:117481136-117481158 GGGAGGTGGGATGGGAAGGGTGG + Intronic
1089435241 11:118459756-118459778 GGGCGGGGGGTTGGGAGGGCCGG - Intronic
1089560188 11:119339863-119339885 GGGCGGCAGGGTGAGAGTAGCGG + Intronic
1089795262 11:120975240-120975262 GGGGTGAGTGATGGGAGTGGAGG + Intronic
1089796660 11:120986292-120986314 GCGGGGCGGGAGGGGAGGGGCGG + Exonic
1089910966 11:122100582-122100604 GGGCAGTTGGGTGGGAGTGGAGG + Intergenic
1089982867 11:122786984-122787006 GGGCGGTGGGGGGGGAGCGGGGG - Intronic
1090238636 11:125166566-125166588 GCGCGGCGGGGCGGGAGCGGTGG + Intronic
1090287756 11:125514836-125514858 GGGTGGCTGGTTGGGCGTGGTGG + Intergenic
1090671264 11:128947304-128947326 GGGCTGCAGGAAGTGAGTGGTGG - Intergenic
1090959079 11:131539749-131539771 GAGCTGGGGCATGGGAGTGGAGG + Intronic
1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG + Intronic
1091225740 11:133955897-133955919 GGGCGGCGGCGGGGGAGGGGAGG - Intronic
1091241127 11:134053139-134053161 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
1091256053 11:134187077-134187099 GGGAGGCTGGCTGGGAGTGGAGG - Intronic
1091460812 12:642661-642683 GGGGGGCGGGCTGGGAGTGGGGG + Intronic
1091718133 12:2794557-2794579 AGGCTGCGGGATGGCAGTGGCGG - Intergenic
1091784392 12:3233952-3233974 GGGCTCCGAGATGGGAGTGCTGG - Intronic
1091838566 12:3602976-3602998 GGGTGGAGGAATGGGGGTGGGGG - Intergenic
1092021646 12:5207634-5207656 GGGCGGAGGGTTGGGAGTTGCGG + Intergenic
1092123407 12:6059922-6059944 GAGAGGCGGGAAGGGAGTGGAGG - Intronic
1092160210 12:6311722-6311744 GTGGGGTGGGCTGGGAGTGGGGG - Intronic
1092181797 12:6451427-6451449 GGTCGGCGGGGTGGGGGTGGAGG - Exonic
1092218391 12:6697673-6697695 GGGGGGCGGGCTGGGGCTGGTGG + Exonic
1092539799 12:9413641-9413663 GGGCGGGGGGCGGGGGGTGGGGG + Intergenic
1092591171 12:9953468-9953490 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1092817370 12:12323180-12323202 GGGGAGCGGGATGGGAGGGGAGG + Intergenic
1093163658 12:15780290-15780312 GGTTGGCATGATGGGAGTGGTGG - Intronic
1093896932 12:24584330-24584352 GGGCGGGAGGGTGGGGGTGGGGG - Intergenic
1094448406 12:30558597-30558619 TGGTGGCGGGTTGGGAGTGGCGG + Intergenic
1094554993 12:31490235-31490257 GGGCGAGAGGATGGGGGTGGCGG + Intronic
1094692702 12:32785588-32785610 GGCCGGGGGGATGTGAGTGAAGG - Intergenic
1095444638 12:42271751-42271773 GAGGGGAGGGAGGGGAGTGGAGG - Intronic
1095687494 12:45051521-45051543 GGAGGGCGGGGTGGGGGTGGGGG + Intergenic
1095967561 12:47879192-47879214 GGGCGGTGGGATGAGGCTGGGGG - Intronic
1096021984 12:48332441-48332463 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1096036214 12:48473476-48473498 AGGGGGCAGGATTGGAGTGGGGG - Exonic
1096578402 12:52569255-52569277 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
1096660821 12:53123001-53123023 GGGCGGGGGGCTGGAGGTGGGGG + Intronic
1096677257 12:53232353-53232375 GGGCGGAGGGATGGGTGGGCGGG + Intronic
1096692307 12:53328708-53328730 GGGCAGCTAGAAGGGAGTGGTGG - Exonic
1096784832 12:54010881-54010903 GGGAGGTGGGGTGGGGGTGGGGG - Intronic
1096848110 12:54418943-54418965 TGGAGACGGGATGGGGGTGGGGG - Intronic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1098106111 12:67069805-67069827 GGGAGGCGGAGAGGGAGTGGCGG - Intergenic
1098312108 12:69158762-69158784 GGGCGGCGGGGTGGGGGCGGCGG - Intergenic
1098557869 12:71839652-71839674 GAGTGGCGGGAAGGGAGTGGAGG - Intergenic
1098685508 12:73415016-73415038 GGGCAAAGGGTTGGGAGTGGCGG - Intergenic
1099665250 12:85619966-85619988 GGCCGGGGGGCTGGGGGTGGTGG + Intergenic
1099973601 12:89524935-89524957 GGGGGCCGGGATGGCAGAGGGGG + Intronic
1100391334 12:94148474-94148496 GGGAGGGGAGATGGGCGTGGAGG + Intergenic
1100961568 12:99968268-99968290 GGGCTGTGGGCTGGGTGTGGTGG + Intronic
1101570172 12:105946504-105946526 GAGCGGGGGGTGGGGAGTGGGGG - Intergenic
1101673337 12:106896687-106896709 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1101673627 12:106898494-106898516 GGGTGGGGGAAGGGGAGTGGAGG + Intergenic
1102077949 12:110074947-110074969 GGGCGGGGGGTTGGGAGGGGGGG - Intergenic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1102173508 12:110859897-110859919 GGGGGAAGGGGTGGGAGTGGGGG - Intronic
1102459310 12:113090441-113090463 TGGCGCAGGGATGAGAGTGGAGG - Intronic
1102461532 12:113102763-113102785 GTGGGGCTGGATGAGAGTGGAGG - Intronic
1102543356 12:113638054-113638076 GGGCGGCCGGCGGGGAGTGGGGG - Intergenic
1102573566 12:113842285-113842307 GGGTTGGGGGATGGGGGTGGCGG + Intronic
1102677422 12:114668134-114668156 GGGAGTGGGGCTGGGAGTGGTGG + Intergenic
1103091207 12:118099308-118099330 GGGCGGCGGGTTGGGGTGGGGGG + Intronic
1103490833 12:121318364-121318386 GGGCAGCGCGATGGTAGGGGAGG + Exonic
1103497579 12:121374701-121374723 GGGCGGGGGGCAGGGGGTGGGGG - Intronic
1103988890 12:124785177-124785199 GGGCCCCGGGCTGGGAGGGGTGG - Intronic
1103988932 12:124785359-124785381 GGGTGGCTGGAGGGGAGTGAGGG - Intronic
1104461448 12:128959463-128959485 GGGGGGCAGCAAGGGAGTGGGGG + Intronic
1104854066 12:131894193-131894215 TGGGGGCGGGAGGGGAGCGGGGG + Intergenic
1105019959 12:132809425-132809447 GGGCGGGGGGGCGGGGGTGGGGG - Intronic
1105541188 13:21319033-21319055 GGGAGGCGGGGCGGGAGAGGTGG + Intergenic
1105725604 13:23159926-23159948 GGGACGCGGGGAGGGAGTGGAGG + Intergenic
1106457012 13:29936266-29936288 GTGCGGGGGGATGGGAGGAGGGG + Intergenic
1106517155 13:30465372-30465394 CGGCGGCGGGAGGGCAGCGGCGG - Intronic
1106552553 13:30784729-30784751 GTGGGGTGGGATGAGAGTGGTGG + Intergenic
1106673977 13:31937569-31937591 TGGTGGAGGGACGGGAGTGGGGG - Intergenic
1107070167 13:36259902-36259924 GGGCGCAGGGAGGGGAGGGGTGG + Intronic
1107102257 13:36606260-36606282 GGGCTGGGGGATGGGATGGGGGG + Intergenic
1107359516 13:39603319-39603341 GAGCGCCGGGAAGGGAGTGGGGG + Intronic
1107753396 13:43593638-43593660 GGGTGGCAGGGTGGGGGTGGGGG - Intronic
1107853209 13:44591253-44591275 GGGTGGCGGGCTGGGGCTGGGGG - Intergenic
1108206454 13:48095015-48095037 GGGAGGCGGTTTGGGAGTGGCGG - Exonic
1108320171 13:49281914-49281936 GGGTGGGGGGAGGGGGGTGGGGG - Intronic
1108364152 13:49693139-49693161 GTGGGGCGGGGCGGGAGTGGGGG + Intergenic
1108484588 13:50910610-50910632 GGGAAGCGGGATGGGAGTCGCGG + Intronic
1109001814 13:56813994-56814016 GGGAGGCTGGCTGGGTGTGGTGG - Intergenic
1109284812 13:60397474-60397496 GGGCGGCGGGGTGCGTGTCGGGG + Intronic
1111802711 13:92999413-92999435 GGGGGTGGGGGTGGGAGTGGGGG + Intergenic
1111812621 13:93110408-93110430 GGGGAGCGGGGTGGGGGTGGGGG - Intergenic
1112580945 13:100675487-100675509 GGGCCCCTGGATGGGAGTGGAGG - Intergenic
1112919830 13:104598283-104598305 GGGCTGGGGGAGGGGTGTGGGGG + Intergenic
1113179775 13:107612063-107612085 GGGGGGAGAGAGGGGAGTGGGGG + Intronic
1113513653 13:110874619-110874641 GGGCGGTGGGAGGGTAGCGGGGG - Intergenic
1113542141 13:111116559-111116581 GGGGGGTGGGGTGGGGGTGGGGG + Intronic
1113614601 13:111671408-111671430 GGGCGGGGGTAGGGGGGTGGCGG + Intronic
1113620068 13:111756322-111756344 GGGCGGGGGTAGGGGGGTGGCGG + Intergenic
1113788242 13:113014178-113014200 GGGTGGGGGGATGGGTGTGGGGG + Intronic
1113924003 13:113930324-113930346 GAGCACCGGGGTGGGAGTGGAGG + Intergenic
1113966508 13:114156041-114156063 GGGTGGAGGGATGGGTGGGGTGG + Intergenic
1114270569 14:21098107-21098129 GGGGGGCGGGGTGGGGGTGGCGG - Intronic
1114400330 14:22404392-22404414 GGGAGGTGGGAGGGGAGTGAGGG - Intergenic
1114473967 14:22981564-22981586 GGGCCGGGGGATACGAGTGGCGG + Exonic
1114524466 14:23359444-23359466 GGCAGGCGGGGTGGGGGTGGGGG + Exonic
1114771307 14:25430731-25430753 GTGAGGCGGGGTGGGGGTGGGGG + Intergenic
1115398513 14:32934634-32934656 GCGCAGCGGGCTGGGGGTGGGGG - Intergenic
1115438153 14:33400766-33400788 GGGGGGCGTGGTGGCAGTGGTGG + Intronic
1115609873 14:35039466-35039488 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1116273873 14:42805761-42805783 GGGCGGCGGGAGGAGCGGGGGGG + Intergenic
1116480671 14:45389960-45389982 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1117235402 14:53769305-53769327 GAGTTGAGGGATGGGAGTGGAGG + Intergenic
1117449705 14:55838976-55838998 TGGGGGCGGGATGGGAGTGATGG + Intergenic
1117547576 14:56805713-56805735 GGGGGTGGGGATGGGGGTGGGGG - Intronic
1117684645 14:58240813-58240835 GGACGGGGGGGTGGGGGTGGGGG - Intronic
1117920433 14:60722347-60722369 GGGCGGCAGCAAAGGAGTGGGGG - Intronic
1118480176 14:66156818-66156840 GGGGGGTGGGAGGGGGGTGGGGG - Intergenic
1118562076 14:67096697-67096719 GGGTGGGGGGTGGGGAGTGGAGG - Intronic
1118932443 14:70255097-70255119 GGGTGGCGGGGAGGGGGTGGGGG - Intergenic
1119003859 14:70907389-70907411 GGGCGGAGGGAGCGGAGAGGAGG + Exonic
1119132537 14:72187685-72187707 GGGCTGAGGGAAGGGAGGGGAGG - Intronic
1119279712 14:73395333-73395355 GGGTGGTGGGCTGGGCGTGGTGG + Intronic
1119472051 14:74906406-74906428 GGGTGGGGGGGTGGGGGTGGGGG + Exonic
1119539327 14:75428276-75428298 GGGCGCCGGGACGGGCGGGGCGG + Intronic
1119653694 14:76401349-76401371 GGGCAGTGGGTGGGGAGTGGAGG + Intronic
1119732026 14:76957120-76957142 GGGCTGAGGGAGGGGGGTGGGGG - Intergenic
1119816235 14:77570896-77570918 GGGCGGGGGGATGGGAACTGAGG + Intronic
1120389185 14:83883750-83883772 GGGCAGAGGGTTGGGAGTGGAGG - Intergenic
1120788683 14:88559712-88559734 GGAAGGTGGGGTGGGAGTGGGGG - Intergenic
1120940866 14:89947986-89948008 GGGCGGTGGGGTGGGAGCAGGGG - Intronic
1120987083 14:90343763-90343785 GGGCGGTGTGGGGGGAGTGGGGG + Intergenic
1121127631 14:91418015-91418037 GGGCGCTGGGAGGGGACTGGTGG + Intergenic
1121339836 14:93098813-93098835 AGGCGGCTGCATGGGAGTGCTGG - Intronic
1121472333 14:94165336-94165358 GCGGGGCGGGTTGGGAGTGGGGG + Intronic
1121485698 14:94312778-94312800 GAGGTGCGGGATGGGAGGGGAGG + Intronic
1121534818 14:94684164-94684186 GGGCCGGGGGATGGGAGAGCTGG - Intergenic
1121873147 14:97427503-97427525 GGGCAGTGAGATGGGAGAGGTGG + Intergenic
1122108773 14:99480826-99480848 CGGCGGCCGGACGGGAGGGGCGG + Exonic
1122411763 14:101529255-101529277 GGGCAGCGGGAGGGGAGATGTGG + Intergenic
1122415163 14:101546073-101546095 GGCGGGCGGGGTGGGGGTGGGGG - Intergenic
1122415725 14:101548653-101548675 GGGCGGAGGGAAGGGAAGGGAGG + Intergenic
1122523564 14:102363495-102363517 GGGACGCGGGCTGCGAGTGGGGG - Intronic
1122550067 14:102544784-102544806 GGGCGACGGCCTGGGCGTGGCGG + Intergenic
1122768854 14:104088184-104088206 GGGAGGTGAGAGGGGAGTGGTGG + Intronic
1122943149 14:104992206-104992228 GCGTGGCGGCATGTGAGTGGTGG - Intronic
1122959608 14:105088348-105088370 GGGCGGAGGGCTGGGGGCGGGGG + Intergenic
1123035619 14:105470787-105470809 GGGCCGCCCGATGGGGGTGGGGG - Intergenic
1202854525 14_GL000225v1_random:42512-42534 GGGCGTGGTGATGGTAGTGGTGG - Intergenic
1202862421 14_GL000225v1_random:90786-90808 GGGCGTGGTGATGGGGGTGGTGG + Intergenic
1123783076 15:23645856-23645878 GGGCTGCCAGATGTGAGTGGGGG + Exonic
1123849749 15:24342865-24342887 GGGGGGCGGAGTGGGGGTGGTGG - Intergenic
1125834712 15:42738620-42738642 GGGCGGAAGGATGAGGGTGGGGG + Intergenic
1126851846 15:52801858-52801880 GGGAGGCGGGTTGGGAGACGAGG - Intergenic
1127252598 15:57256549-57256571 GTGGGGCGGGGTGGGGGTGGGGG - Intronic
1128143167 15:65316477-65316499 GGGCGGTGGGGCGGGAGGGGTGG - Intergenic
1128635431 15:69299396-69299418 GGGCGGCGGGAGGGGGGCGGTGG - Intronic
1128793729 15:70450288-70450310 GGGTGGATGGATGGGGGTGGAGG + Intergenic
1129189136 15:73927407-73927429 GGGCGGCGGCGTGGGCGCGGGGG + Exonic
1129274089 15:74434017-74434039 GGGCGGGGGGAGGGGCGGGGTGG - Exonic
1129428585 15:75481714-75481736 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1129463638 15:75712155-75712177 GGGCAGCTGGAGGGGTGTGGGGG + Intronic
1129468502 15:75737695-75737717 CGGGGGCGGGGTGGGGGTGGAGG + Intergenic
1129521100 15:76186793-76186815 GGGTGGAGTGGTGGGAGTGGTGG - Intronic
1129690880 15:77712641-77712663 GGGAGGCAGGAGGAGAGTGGAGG - Intronic
1129710647 15:77818964-77818986 GCGCGGCGGGCCGGGAGGGGTGG - Intronic
1129721250 15:77879247-77879269 GGGCAGCTGGAGGGGTGTGGGGG - Intergenic
1129862521 15:78873410-78873432 TGGCGGCGGGGGGGGAGGGGCGG + Intronic
1129893873 15:79089840-79089862 GGGCTGGGCGGTGGGAGTGGGGG + Intronic
1130010901 15:80152630-80152652 GGGCGGGGCGAGGGGAGGGGCGG + Intronic
1130224351 15:82046067-82046089 GGGCGGGAGGGAGGGAGTGGAGG - Exonic
1130302840 15:82693183-82693205 GGGCGGGGGGGTGGGGGCGGGGG - Intronic
1131050941 15:89347393-89347415 GGGGGGAGGGGTGGGAGTGAGGG - Intergenic
1131133089 15:89912651-89912673 GGGGGGTGGGATGCGGGTGGGGG - Intronic
1131144554 15:90002378-90002400 GGGCGTGGGGGTGGGGGTGGCGG + Intronic
1131260014 15:90883277-90883299 GGGCAGGGGGATGGGAGAGGAGG - Exonic
1131396040 15:92087148-92087170 GGGCGGAGGGAGGGGGGTGGTGG - Intronic
1131473271 15:92714603-92714625 GGGCCGCGGGAAGGGAGAGGAGG - Intronic
1131582926 15:93663016-93663038 GGGGGGGGGGGTGGGGGTGGTGG + Intergenic
1131846507 15:96494978-96495000 AGGGGGAGGGATGGGAGTGTTGG + Intergenic
1131977467 15:97960852-97960874 GCCCGGCGGGATGGGCGGGGAGG + Exonic
1132394052 15:101459456-101459478 GGGTGGGGGGACGGGAATGGTGG - Intronic
1132462711 16:63313-63335 GTGCTGTGGGGTGGGAGTGGTGG - Intronic
1132553170 16:561453-561475 GGGCGGCGGGCAGGGAGAAGGGG + Intronic
1132585808 16:705415-705437 AGGGGGCGGGGTGGGGGTGGGGG - Intronic
1132595246 16:746180-746202 GGGTGGCAGGAGGGGAGAGGTGG + Intronic
1132595258 16:746221-746243 GGGCTGCAGGAGGGGAGAGGTGG + Intronic
1132595291 16:746355-746377 GGGCAGCAGGAGGGGAGAGGTGG + Intronic
1132595303 16:746396-746418 GGGCTGCAGGAGGGGAGAGGTGG + Intronic
1132595355 16:746618-746640 GGGCAGCAGGAGGGGAGAGGTGG + Intronic
1132687699 16:1169156-1169178 CTGCGGCGGGGTGGGGGTGGGGG + Intronic
1132807780 16:1783011-1783033 AGGCGGCGGGATGGAGGCGGCGG + Exonic
1132897878 16:2237488-2237510 GCTCGGCGGGAGGGGAGGGGCGG - Exonic
1132973872 16:2702007-2702029 GGGCAGCGGGAGGAGAGTGGAGG - Intronic
1132975059 16:2706885-2706907 GGGCGTCGGGGTGGGGGTGGGGG + Intronic
1133448581 16:5884459-5884481 GGGCGGGGGTAGGGGGGTGGTGG - Intergenic
1133622381 16:7538850-7538872 GAGTGGCGGGGTGGGGGTGGGGG - Intronic
1134063316 16:11211738-11211760 GTGCAGCGGTAGGGGAGTGGAGG - Intergenic
1134087374 16:11367196-11367218 GGGCGGGGGGAGGGGTGCGGAGG - Intronic
1134112415 16:11523913-11523935 GGGTGGGTGGATAGGAGTGGGGG - Intergenic
1134319979 16:13153945-13153967 GAGGGCTGGGATGGGAGTGGGGG + Intronic
1135048491 16:19173387-19173409 GGGCGGGGGGATGGGGGAGAGGG - Intronic
1135869236 16:26134145-26134167 GGATGGAGGAATGGGAGTGGAGG + Intronic
1135973176 16:27087128-27087150 GGGCAGAGTGATGGGAGAGGTGG - Intergenic
1135986564 16:27188720-27188742 GGGAAGCGGGAGGGGAGGGGAGG + Intergenic
1136111084 16:28063831-28063853 GGGCGGGGGCCTGGGAGTGGAGG + Intergenic
1136141581 16:28292316-28292338 GCGCGGCCGGAAGGGGGTGGGGG + Intergenic
1136248728 16:28989916-28989938 GGGCGGCTGTAAGGGAGGGGAGG - Exonic
1136366075 16:29809785-29809807 GGGGGGCGGGATGGGGGGTGTGG + Intronic
1136370237 16:29831550-29831572 GGGTGGCTGGAGGTGAGTGGAGG - Intronic
1136419543 16:30123212-30123234 GGGCGGTGGGAGGGGAGGAGTGG - Exonic
1136453986 16:30370193-30370215 CGGCGGGGGGATGTGAGGGGCGG - Exonic
1136530435 16:30864835-30864857 GGGTGGGGGGGTGGGGGTGGGGG - Intronic
1136579490 16:31142991-31143013 GGGCTGCGGGATGGGGGCCGAGG + Exonic
1136618431 16:31412469-31412491 GGCCAGAGAGATGGGAGTGGCGG - Intronic
1136713402 16:32258295-32258317 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136754509 16:32671136-32671158 GGTGGGGGGGAGGGGAGTGGGGG - Intergenic
1136813604 16:33199229-33199251 GTGGGGGGGGAGGGGAGTGGGGG + Intronic
1136820080 16:33309309-33309331 GTGGGGGGGGAGGGGAGTGGGGG + Intergenic
1136826643 16:33365848-33365870 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136831709 16:33464619-33464641 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136913089 16:34159899-34159921 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1137027054 16:35486678-35486700 GGGCCCCGGGATGGGTGGGGGGG - Intergenic
1137719767 16:50621277-50621299 GGGCAGATGGATGAGAGTGGAGG - Intronic
1137783056 16:51114042-51114064 AGGGGGCAGGATGGGGGTGGGGG + Intergenic
1137943144 16:52708616-52708638 GGGTGGGGGGAAGGGAGTGGAGG + Intergenic
1138071569 16:53997569-53997591 GCGGGGCGGGGTGGGAGTGGGGG + Intronic
1138120896 16:54400435-54400457 GTCTGGAGGGATGGGAGTGGTGG - Intergenic
1138379290 16:56589305-56589327 CGGATGCGGGGTGGGAGTGGGGG + Intronic
1138463794 16:57171697-57171719 GGGCAGTGTGATGAGAGTGGGGG + Intronic
1138851991 16:60640759-60640781 GGGCTGGGGGATGGGGGTGGGGG + Intergenic
1139136091 16:64206246-64206268 GGGTGGGGGGGTCGGAGTGGTGG + Intergenic
1139355859 16:66366782-66366804 GGGTGGCGGGTTTGGGGTGGAGG - Intronic
1139375056 16:66491643-66491665 GGGTGGAGGGATGGGGGCGGGGG + Intronic
1139432530 16:66918783-66918805 GGGTGAGGGGCTGGGAGTGGAGG - Exonic
1139493480 16:67299779-67299801 GGGAGGTGAGTTGGGAGTGGGGG + Intronic
1139676280 16:68526224-68526246 GGGAGGAGGGAAGGGAGAGGAGG - Intergenic
1139750448 16:69106462-69106484 GGGAGGCGGGTTGGGGGCGGCGG + Intronic
1140253730 16:73317274-73317296 GGGGGGTGGGGTGGGGGTGGCGG + Intergenic
1140270959 16:73465925-73465947 AGGGGGTGGGGTGGGAGTGGGGG - Intergenic
1140313715 16:73873012-73873034 GGGTGGCGGGTGGTGAGTGGCGG + Intergenic
1140409863 16:74734965-74734987 GGGCTGCGGGAGAGGAGTGGGGG + Intronic
1140804437 16:78520091-78520113 TGTGGCCGGGATGGGAGTGGAGG - Intronic
1140909429 16:79438119-79438141 GGGCAGGGGGAAGAGAGTGGGGG + Intergenic
1141128751 16:81420108-81420130 GGGCAGGGGGCTGGGCGTGGTGG + Intergenic
1141132332 16:81444893-81444915 GGGCGCCGGGGTGGGGGCGGCGG - Intergenic
1141524671 16:84603964-84603986 GGGAGGTGGGTGGGGAGTGGCGG - Intronic
1141683356 16:85556575-85556597 CGGCGGCGCGATGGGGGCGGCGG - Intergenic
1141770800 16:86088752-86088774 GGGGGGCGGGGTGGGAGGGGTGG - Intergenic
1141856123 16:86682656-86682678 GGGCGGCTGGATGGGTGTTCCGG - Intergenic
1141886496 16:86895827-86895849 GGACGGCGGGATGGGCACGGTGG + Intergenic
1141900350 16:86986892-86986914 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1142214712 16:88824867-88824889 GGCCTGTGGGATGGGAGGGGAGG + Exonic
1142364856 16:89644842-89644864 GGGCGGCTGGCAGGGAGTGCGGG - Exonic
1202992180 16_KI270728v1_random:22203-22225 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1203056656 16_KI270728v1_random:931467-931489 GGTGGGGGGGAGGGGAGTGGGGG - Intergenic
1142665767 17:1462914-1462936 GGGCGGCGCGCTGTGGGTGGAGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142687443 17:1585870-1585892 GGGCTGCGGGCTGGGAGCCGGGG + Intronic
1143116601 17:4584895-4584917 GGGCGGGGGGCTGGGCGTGCCGG - Exonic
1143434667 17:6914720-6914742 GGGGGGGGGGAGGGGCGTGGTGG - Intronic
1143487457 17:7262552-7262574 GGGAGGCGGGACCGGAGGGGCGG + Intronic
1143585554 17:7848665-7848687 GGGCTGGGGGGTGGGGGTGGTGG - Exonic
1143648515 17:8248080-8248102 GGGGGTGGGGATGGGGGTGGGGG + Intronic
1143677695 17:8447979-8448001 GGGCGGGGGGGGGGCAGTGGGGG + Intronic
1143976872 17:10836791-10836813 GGAAGGCAGGATGGAAGTGGTGG + Intronic
1144454790 17:15409758-15409780 GGTCTGCGGGATGGCCGTGGCGG - Intergenic
1144842203 17:18194145-18194167 GGGCGGGGGGCAGGGGGTGGGGG + Intronic
1145058119 17:19716394-19716416 GGGGGGCAGGTAGGGAGTGGAGG - Intronic
1145816439 17:27798362-27798384 TGGCGGAGGGGTGGGGGTGGAGG - Intronic
1145999303 17:29121822-29121844 GGGCAGGGGGCTGGGTGTGGGGG - Intronic
1146001565 17:29133501-29133523 GGGTGGTGGGAAGGGTGTGGAGG + Intronic
1146176364 17:30668372-30668394 GGCCGGGGGGTTGGGAGTGGGGG + Intergenic
1146229527 17:31095390-31095412 GGGAGGTGGGAGCGGAGTGGGGG + Intronic
1146333458 17:31949648-31949670 GGGGGGGGGGCTGGGTGTGGTGG - Intronic
1146349824 17:32084486-32084508 GGCCGGGGGGTTGGGAGTGGGGG + Intergenic
1146358787 17:32157802-32157824 GGGCGGCGGGGTGGGAGCGGGGG - Intronic
1146721114 17:35124143-35124165 GGGAGGCTGGATGGGAGTAAGGG + Intronic
1146908425 17:36632603-36632625 GGGTGGGGAGATGGCAGTGGGGG - Intergenic
1147156037 17:38544879-38544901 GGGCGGAGGGGTAGGGGTGGGGG + Intronic
1147193136 17:38748570-38748592 GGGCGGCCGCATGGGAAGGGAGG - Intronic
1147620660 17:41864777-41864799 GGGCGGCGGGCGCGGAGAGGGGG - Intronic
1147909576 17:43847383-43847405 GCGGGGCGGGCTGGGGGTGGGGG + Intronic
1147971742 17:44221900-44221922 GGGTGTCGGGGTGGGAGTTGCGG + Intergenic
1148330708 17:46812323-46812345 GGGCGGGGGTAGGGGGGTGGAGG - Intronic
1148342844 17:46883872-46883894 TTGAGGAGGGATGGGAGTGGGGG - Intronic
1148432085 17:47650457-47650479 ACGCGGCGGGATGGGCGCGGCGG - Intronic
1148454894 17:47805891-47805913 AGGTGGTGGGGTGGGAGTGGGGG + Intergenic
1148457693 17:47819914-47819936 GGGGGGCGGGGTGGGAATGGGGG - Intronic
1148690637 17:49524977-49524999 GGGTGAGGGGCTGGGAGTGGAGG - Intergenic
1148735485 17:49862650-49862672 GGGCGGCGGGATGGGCCAGAGGG - Intergenic
1148846533 17:50533134-50533156 GGGCGGCAGGGAGGGAGGGGTGG - Intronic
1148859530 17:50596796-50596818 GGGCAGCGACATGGGTGTGGCGG - Exonic
1148876484 17:50690331-50690353 GATCGGCGGGAGGGGAGGGGGGG + Intronic
1148891026 17:50807183-50807205 GGGAGGGGGAATGGGAGTGATGG + Intergenic
1148904116 17:50900712-50900734 GGGAGGCGAGCTGGGAGGGGAGG + Intergenic
1149387908 17:56159967-56159989 GGGCAGAGAGATGGGAGGGGTGG + Intronic
1149428316 17:56576767-56576789 GGGTTGGGGGCTGGGAGTGGTGG + Intergenic
1149459167 17:56813207-56813229 GGCTGGCGGGTTGGGGGTGGGGG - Intronic
1149993544 17:61395827-61395849 GGGCGGCGGTGGGGGAGTGGGGG - Intergenic
1150008399 17:61483802-61483824 CGTGGGTGGGATGGGAGTGGAGG + Exonic
1150273682 17:63882487-63882509 GGGCGTGGGGATGGGGGTGGGGG + Intergenic
1150358157 17:64506021-64506043 GGGTGGGGGGATGGGAGGGCGGG - Intronic
1150640329 17:66945367-66945389 GGGGGGTGGGATGGGGGTGGAGG + Intergenic
1151013809 17:70531202-70531224 GGGTGGAGGGTTGGGGGTGGAGG + Intergenic
1151128051 17:71866315-71866337 GGGTGGCAGGAAGGGAGGGGCGG - Intergenic
1151525975 17:74668398-74668420 GGGCGGGGGGGGGGGTGTGGGGG - Intergenic
1151957518 17:77387885-77387907 GGGGGGCGGGAAGGGGGAGGTGG - Intronic
1151981277 17:77510689-77510711 GGGCGGCCGGTTGGGTGGGGAGG + Intergenic
1151990568 17:77571406-77571428 GGGAGGCGGGAGGGGAGGCGAGG + Intergenic
1152024562 17:77800298-77800320 GGGCGGGGGGTGGGGGGTGGTGG + Intergenic
1152082970 17:78199896-78199918 GGGTGACAGGATGGGAGAGGTGG + Intronic
1152085086 17:78213192-78213214 TGGGGGCGGGGTGGGAGGGGTGG + Intergenic
1152185634 17:78854918-78854940 GGGCGGGGGGGGGGGGGTGGGGG + Exonic
1152193839 17:78904580-78904602 GGGCGGGGGTAGGGGGGTGGTGG - Intronic
1152410515 17:80120453-80120475 GGGAGGTGGGGTGGGAGGGGAGG - Intergenic
1152477765 17:80529271-80529293 GGGGGGCGGGCAGGGAGGGGGGG - Intergenic
1152552050 17:81034925-81034947 GGGGGGCGGGATCGGAGGTGGGG - Intergenic
1152623987 17:81380015-81380037 GGGAGGCGGGGGGGGAGCGGAGG - Intergenic
1152762967 17:82119098-82119120 GGGGGTGGGGGTGGGAGTGGGGG + Intronic
1152793241 17:82293261-82293283 GGGCGCGGGCAGGGGAGTGGAGG + Intergenic
1152793353 17:82293493-82293515 GGGCTGCGGGGAGGGAGGGGCGG + Intergenic
1153063724 18:1021192-1021214 GAGGGGCGAGATGGAAGTGGGGG - Intergenic
1153245056 18:3065550-3065572 GGGTGGCGGGGTGGGGGTGGGGG - Intergenic
1153458224 18:5302852-5302874 GGGTGGCGGGGTGGCAGGGGTGG - Intergenic
1153997401 18:10454425-10454447 GGGAAGCGGGAGGGGAGCGGGGG + Intergenic
1154014933 18:10607669-10607691 GCGGAGCGCGATGGGAGTGGCGG + Intergenic
1154190580 18:12227975-12227997 GCGGAGCGCGATGGGAGTGGCGG - Intergenic
1154216606 18:12420646-12420668 GGGGCGCGGGGTGGGGGTGGCGG + Intronic
1154377345 18:13821261-13821283 GGAGGGAGGGATGGGAGGGGAGG - Intergenic
1155193760 18:23453647-23453669 GGGTGCCGGGATGGGGATGGAGG + Intronic
1155229163 18:23756931-23756953 GGGGCGGGGGAAGGGAGTGGGGG - Intronic
1155285301 18:24282071-24282093 GGGGGTAGGGTTGGGAGTGGGGG - Intronic
1155356643 18:24960120-24960142 GGGCGGGGGGGTGGGGGGGGTGG - Intergenic
1155519653 18:26656319-26656341 GGGAGGCGGGGAGGGGGTGGGGG - Intronic
1155540420 18:26863501-26863523 GTGGGGAGAGATGGGAGTGGGGG + Intronic
1155602793 18:27568846-27568868 GGGGGTGGGGCTGGGAGTGGGGG + Intergenic
1155707656 18:28837127-28837149 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1156075648 18:33275657-33275679 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1156469172 18:37366845-37366867 AGAGGGTGGGATGGGAGTGGAGG - Intronic
1156843767 18:41639198-41639220 GGGAGGGGGAATGGGAGGGGAGG + Intergenic
1157297737 18:46458163-46458185 GGGTGTCGGGATGGGGGTGCTGG + Exonic
1157354043 18:46917271-46917293 GGGGGAGGGGATGGGAGAGGAGG - Intronic
1158434210 18:57423141-57423163 GGGCTGGGGAGTGGGAGTGGGGG + Intergenic
1158642178 18:59213260-59213282 TGGGGGTGGGATAGGAGTGGGGG + Intergenic
1158654858 18:59321523-59321545 GGGGGTCGGGGTGGGGGTGGGGG - Intergenic
1158887693 18:61844225-61844247 GGGAGACGGGAGGGGAGGGGAGG + Intronic
1159599660 18:70416670-70416692 GGGCTGTGGGATGTGAGGGGCGG + Intergenic
1159917572 18:74200237-74200259 GGGCGGGGGGCTGGGAGTGTGGG + Intergenic
1160499323 18:79394488-79394510 GGGCGCCGGGAGGGGAGGAGGGG - Intergenic
1160680104 19:408493-408515 TGCCGGCGGGGTGGGGGTGGAGG + Intronic
1160710435 19:548830-548852 GGGGGGAGGGGTGGCAGTGGGGG - Intronic
1160790666 19:921840-921862 GGCCGGCGGGAGGGGAGGGGGGG - Intergenic
1160971143 19:1768280-1768302 GGGGGGCGGGAGGGGACTTGGGG + Intronic
1160999844 19:1905185-1905207 GGGCGGCGGGAGGGGAGGAGAGG - Intergenic
1161026873 19:2041000-2041022 GGGCGGCAGGAGGGGTATGGGGG - Intronic
1161056877 19:2195125-2195147 TGGCAGTGGGATGGGTGTGGGGG + Intronic
1161109573 19:2461932-2461954 GGGCAGCGCGATGGGGTTGGGGG - Intergenic
1161236662 19:3201641-3201663 GGGCAGGGGGATGGGGGTGCGGG + Intronic
1161262512 19:3345637-3345659 GGGCGGCGGGAGGGGGGGGCGGG - Intergenic
1161322312 19:3646945-3646967 GGGAGGAGGGATGGGAGGAGGGG + Intronic
1161322334 19:3647020-3647042 GGGAGGAGGGATGGGAGGAGGGG + Intronic
1161329805 19:3681126-3681148 GGTATGTGGGATGGGAGTGGGGG + Intronic
1161348539 19:3779622-3779644 GGGCGGTGGGGTGGGCGTGAGGG + Intronic
1161401228 19:4066950-4066972 GGGGGGCGGGCTGGGCGTGGGGG - Intergenic
1161443356 19:4304836-4304858 TGGAGGCGGGGAGGGAGTGGGGG - Intronic
1161487463 19:4543744-4543766 TGGCGGCCGGAGGGGCGTGGGGG + Exonic
1161507105 19:4649973-4649995 TGGCGCTGGGGTGGGAGTGGAGG + Intronic
1161608827 19:5229687-5229709 GGCGGGCGGGAGGGGAGGGGAGG + Intronic
1161609224 19:5231652-5231674 GGGAGGTGGGATGGGTGGGGAGG + Intronic
1161612493 19:5250941-5250963 GGGCGGCGGGGGGGGGGGGGGGG + Intronic
1161635367 19:5385348-5385370 AGGCGGTGGGACGGGCGTGGTGG + Intergenic
1161658352 19:5529924-5529946 GGTGGGGGTGATGGGAGTGGGGG + Intergenic
1161985340 19:7650393-7650415 GGGCGAAGGGAAGGGAGGGGAGG + Intergenic
1162012128 19:7823575-7823597 GGGAGGAGGGAGGGGAGGGGAGG + Intergenic
1162012135 19:7823592-7823614 GGGAGGAGGGAGGGGAGCGGAGG + Intergenic
1162076907 19:8194095-8194117 GGGGGAGGGGATGGGAGTGCAGG - Intronic
1162372952 19:10289947-10289969 GCGCGGCGGGTGGGGTGTGGGGG - Intergenic
1162389342 19:10379992-10380014 GGGCGCCAGTATGGAAGTGGAGG + Intronic
1162396459 19:10420451-10420473 GGGCGGGGGGCGGGGAGGGGCGG + Intronic
1162578538 19:11513608-11513630 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1162757921 19:12871319-12871341 GGGCTGCGGGCTGGGCGCGGTGG + Intronic
1162762614 19:12897447-12897469 GGGCGGGGGGATGGCAGCGGTGG + Intronic
1162818183 19:13208511-13208533 GGGCGGCGGGGAGGGGGCGGCGG + Intronic
1162822451 19:13231352-13231374 GGGGGTGGGGTTGGGAGTGGGGG - Intronic
1162890856 19:13732095-13732117 GGACTTCGGGGTGGGAGTGGTGG + Intronic
1162952598 19:14080877-14080899 GGGCGGGGGGAGGGGAGGGGAGG + Intergenic
1162982461 19:14248525-14248547 GGCCGGGGGGTTGGGAGTGGGGG - Intergenic
1163143206 19:15363544-15363566 GGGCGGCTGGCTGGGCGAGGGGG - Intronic
1163265015 19:16215197-16215219 GGGCGGGGGGGGGGGAGAGGGGG + Intronic
1163314970 19:16535539-16535561 GGCCGGCGGGATGGGCGCGGCGG + Exonic
1163334514 19:16661852-16661874 GGGGGAAGGGAGGGGAGTGGAGG - Intronic
1163611538 19:18304405-18304427 GGGATGGGGGATGGGAGTGGGGG + Intergenic
1163635826 19:18436928-18436950 GTGGGGCGGGATGGGAGATGGGG - Intronic
1163636033 19:18437575-18437597 TGGGGGCGGGAGGGGCGTGGTGG - Intronic
1163674699 19:18649741-18649763 GGGGGGCAGGAAGGGACTGGAGG - Intronic
1163681955 19:18687858-18687880 GGGCGGAGGGGTGGGTGTGTGGG + Intronic
1163725869 19:18922756-18922778 GGGCGGTGGGAGGGGAGAGGCGG - Intronic
1163729639 19:18941408-18941430 GGGCGGTGGAGGGGGAGTGGGGG + Intergenic
1163743718 19:19032914-19032936 GGGCTGAAGGATGGGACTGGGGG - Intronic
1163807776 19:19410335-19410357 GGGGTGGGGGATGGGGGTGGTGG + Intronic
1164647453 19:29870171-29870193 GGGCCGGGGGGTGGGGGTGGGGG - Intergenic
1164652484 19:29899578-29899600 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1164653080 19:29900918-29900940 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1164732773 19:30518854-30518876 GGGCAGAGGGATGGGGGTGCAGG + Intronic
1164833421 19:31340517-31340539 GGGCGGCGGGCAGGGAGGAGGGG + Intronic
1165040235 19:33063803-33063825 GGGCGGCGGGCGGCGGGTGGCGG - Intronic
1165040550 19:33064957-33064979 GCGGGACGGGGTGGGAGTGGAGG - Intergenic
1165156548 19:33792330-33792352 GGGCGGGGGGGTGGGGGTTGGGG - Intergenic
1165404100 19:35619500-35619522 GGGAGGTGAGATGGGAGTTGGGG + Exonic
1165445697 19:35855976-35855998 GGGAGTGGGGTTGGGAGTGGGGG - Intronic
1165788756 19:38478212-38478234 GGGAGTCAGGATGGGGGTGGGGG - Intronic
1165827983 19:38716484-38716506 TGGCGGGGGCATGGGAGTGGAGG + Intronic
1166020657 19:40025519-40025541 GGGAGTGGGGAGGGGAGTGGGGG + Intergenic
1166261682 19:41645019-41645041 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1166367433 19:42284547-42284569 GGGCGGCCGGAGGGGGGCGGCGG + Intronic
1166627998 19:44378186-44378208 GGGCGGGGGGAGGGGGGAGGGGG + Intronic
1166661098 19:44647730-44647752 GGGTGGGGGGAGGTGAGTGGGGG + Intronic
1166688566 19:44809863-44809885 GGGCTGGGGGGTGGGGGTGGGGG + Intronic
1166747220 19:45147027-45147049 GGGTGGGGGGATGGGAGCAGAGG + Exonic
1166765764 19:45251543-45251565 GGGCGGCCGGGTGGGGGGGGCGG - Exonic
1166795577 19:45423581-45423603 GGGCGGAGCGATGGGACTTGTGG - Intronic
1166892096 19:46000073-46000095 CAGCGGCGGGAGGGGAGAGGGGG + Intronic
1166948046 19:46409159-46409181 GGGAGAGGGGAGGGGAGTGGAGG + Intergenic
1166948057 19:46409188-46409210 GGGAGAGGGGAGGGGAGTGGAGG + Intergenic
1167175193 19:47860289-47860311 GGCGGGCGGGGTGGGGGTGGGGG - Intergenic
1167426582 19:49432751-49432773 GGTCGGCGGGAGGGAACTGGCGG - Intronic
1167428405 19:49441414-49441436 GGGCGGGGGGATCGGCGGGGGGG - Exonic
1167441799 19:49513136-49513158 GGGGGGCGGAAGGGGCGTGGCGG + Intronic
1167578530 19:50329088-50329110 GGGGGGCGGGGCGGGAGGGGCGG + Exonic
1167649102 19:50719833-50719855 GGGCGGAGGGAGGGGAGGGAGGG - Intergenic
1167738673 19:51311699-51311721 GGGCGGGGGGAGGGGGCTGGGGG - Intergenic
1167970574 19:53186683-53186705 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
1168020770 19:53607158-53607180 GGGAGTGGGGATGGCAGTGGGGG - Intergenic
1168076538 19:53983174-53983196 GGGCGGGGGGAGGGGAGGGAGGG + Exonic
1168212787 19:54902840-54902862 AGGAGGCGGGCTGGGTGTGGTGG + Intergenic
1168240981 19:55088808-55088830 GGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1168270090 19:55245219-55245241 GGGTGGGGGGCTGGGCGTGGTGG - Intronic
1168315194 19:55481990-55482012 GGGCGGCGGGGCGGGAGGCGCGG - Exonic
1202683842 1_KI270712v1_random:31291-31313 CGGCGGCGGGGGGGGAGGGGTGG - Intergenic
924993296 2:334466-334488 GGGTGGGGGGATGGGGGAGGGGG + Intergenic
925169840 2:1743911-1743933 GGGCGGCGGGAGGCGAGCGGGGG + Intronic
925418439 2:3690372-3690394 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
925418450 2:3690389-3690411 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
925420212 2:3704508-3704530 GGGAGGGGGGAGGGGCGTGGGGG + Intronic
925420301 2:3704706-3704728 GGGAGGGGGGAGGGGCGTGGGGG + Intronic
925927638 2:8681784-8681806 GGGCGGGGGGCGGGGAGCGGCGG - Intronic
926172188 2:10559341-10559363 GGGCAGCAGGATGGGGGTGTGGG - Intergenic
926422953 2:12716880-12716902 GGGCGGCGGGGGGGGGGCGGAGG + Exonic
926641703 2:15244602-15244624 GGGTGTCGGGGTGGGTGTGGGGG + Intronic
926720543 2:15957155-15957177 GGGGGGCGGGGTGGGGGTAGGGG - Intergenic
927175024 2:20399727-20399749 GGGCCCCGGGATGGTAGTGGGGG + Intergenic
927606595 2:24491591-24491613 CGGCGGCGGCAGGTGAGTGGCGG + Intergenic
927633433 2:24793648-24793670 GGGCCGCGGGATGGGCGCGGGGG + Intronic
927649995 2:24906741-24906763 GGGCAGCGGGGTGGGAGCAGGGG - Intronic
927789806 2:26001397-26001419 GGGTGGGGGGCTGGGCGTGGTGG - Intergenic
927843773 2:26461073-26461095 GTGGGGCGGGGTGGGGGTGGGGG + Intronic
927983505 2:27390813-27390835 GTGCGGCAGGGTGGGGGTGGGGG - Intronic
928016944 2:27666361-27666383 GGGGGGCGGGGTGGGGGGGGGGG - Intronic
928095376 2:28401561-28401583 GAGCTGCTGGATGGGAGGGGCGG - Intronic
928107151 2:28477951-28477973 GGGAGCAGGGATGGGCGTGGGGG - Intronic
928149142 2:28810696-28810718 GGGCGGGGGGCAGGGAGGGGCGG + Intronic
928303569 2:30147465-30147487 GCGCGGCGGGTTGGGGGTCGCGG - Intronic
928585495 2:32754801-32754823 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
929211882 2:39366266-39366288 GGGTGGTGGGGTGGGGGTGGAGG + Intronic
929261682 2:39873070-39873092 GGAGGGAGGGATGGGAGGGGAGG - Intergenic
929606665 2:43239352-43239374 GGGGCGGGGGATGGGGGTGGAGG - Intronic
929673767 2:43903573-43903595 GGGGGGTGGGGTGGGGGTGGGGG + Intronic
929808433 2:45169076-45169098 GGACGGCAGGCGGGGAGTGGAGG + Intergenic
930639518 2:53840587-53840609 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
930821518 2:55651083-55651105 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
931029454 2:58155755-58155777 GGGCGGCGGGGTGGGGGGGATGG - Intronic
931156057 2:59631579-59631601 GGAAGGTGGGATGGGAGTGAGGG - Intergenic
931348892 2:61470964-61470986 GGACGGGGGGAGGGGAGAGGGGG + Intergenic
931515587 2:63049139-63049161 GGGAGGAGGGGTGGGAGTGGGGG - Intergenic
931681219 2:64751205-64751227 GGGCGGGGGCAGTGGAGTGGGGG + Intergenic
931925757 2:67070747-67070769 GGGAGTTGGGCTGGGAGTGGAGG + Intergenic
932495197 2:72142740-72142762 GGGCGGCGGGAGAGGAGTTCTGG - Intronic
932807388 2:74795871-74795893 GGGCGGCTGGCCGGGCGTGGGGG + Intergenic
933613379 2:84459586-84459608 AGGCGGCGGGAAGGGAGCGAGGG + Intronic
933728178 2:85437973-85437995 GGGCGGGGGGCTGGGGGCGGGGG + Intergenic
934033050 2:88065225-88065247 GGGAGGGGGGAGGGGAGGGGAGG - Intergenic
934033073 2:88065260-88065282 GGGGGGGGGGAGGGGAGGGGAGG - Intergenic
934475978 2:94593804-94593826 AGGTGGCGGGGTGGGACTGGAGG - Intronic
934554147 2:95278564-95278586 GGGCCAGGGGATGGGAGAGGAGG + Intronic
935111222 2:100096073-100096095 GGTTGGGGGGATGGGAGTGTTGG - Intronic
935232112 2:101108086-101108108 GGGGGGAGGGAGGGGAGGGGAGG + Intronic
936546533 2:113395264-113395286 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
936962261 2:118088464-118088486 GGGCGGAGTTGTGGGAGTGGAGG + Exonic
937221360 2:120344723-120344745 GGGGGGTGGGAGGGGAGAGGAGG + Intergenic
937246838 2:120499162-120499184 AGGCGGCAGGAAGAGAGTGGAGG - Intergenic
937283391 2:120735727-120735749 GGGCGGGGGGAGGGGAAAGGGGG - Intronic
937596590 2:123682240-123682262 GGACGGCCGGCTCGGAGTGGGGG + Intergenic
937907160 2:127058016-127058038 GGCCTGCGGGAAGGGAGAGGTGG - Intronic
938537099 2:132256304-132256326 GGGTGGTGGGAGGGGGGTGGTGG + Intronic
938583382 2:132668339-132668361 GGGCTGTGGGGTGGGAGTGAGGG - Intronic
939520155 2:143220292-143220314 GGGTGGATGGATGGGGGTGGAGG - Intronic
939628316 2:144505602-144505624 AGGAGGTGGGCTGGGAGTGGGGG + Intronic
940646043 2:156393983-156394005 CGGGGGCGGGAAGGGGGTGGGGG + Intergenic
941917825 2:170823656-170823678 TGGCGGCAGGGTGGGGGTGGAGG - Intronic
941951501 2:171160847-171160869 CGGCGGCGGGCTGTGGGTGGCGG + Intronic
942240986 2:173964273-173964295 GGGCGGGGGGAGGGGAGTGGAGG + Intronic
943464892 2:188217522-188217544 GGGAGGGGGGAGGGGAGGGGAGG - Intergenic
943639431 2:190343153-190343175 GGTGGGCGGGGTGGGGGTGGGGG - Intronic
944058090 2:195544214-195544236 GGTGGGGGGGATGGGAGGGGAGG + Intergenic
944897356 2:204178436-204178458 GAGCTGGGGGATGGGGGTGGAGG - Intergenic
945648814 2:212536298-212536320 GTGCGGCAGGGTGGGGGTGGGGG + Intronic
946064685 2:216976390-216976412 GGTTGGGGGGCTGGGAGTGGTGG - Intergenic
946174375 2:217913501-217913523 GGGTGGCTGGAGGGGTGTGGAGG - Intronic
946292307 2:218754550-218754572 GGCCGGAGGGATGGTAGTGATGG + Exonic
946431906 2:219630754-219630776 GGGTAGTGGGATGGGAGTGAAGG - Intronic
946537373 2:220646511-220646533 GGCCTGCTGGAGGGGAGTGGGGG + Intergenic
946830837 2:223726636-223726658 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
947590644 2:231383227-231383249 AGGCAGCGGGCTGGGAGTCGGGG + Intergenic
947792466 2:232876115-232876137 GGGCGGCGGTACGGGCGGGGCGG + Exonic
947796439 2:232896676-232896698 GGGGGTAGGGATGGGGGTGGGGG + Intronic
948035978 2:234858505-234858527 GTGGGGTGGGGTGGGAGTGGTGG - Intergenic
948097720 2:235349765-235349787 GTGTGGCGGGAGGGCAGTGGAGG + Intergenic
948467351 2:238158824-238158846 GGGCGGGGGAGGGGGAGTGGGGG - Intergenic
948753325 2:240144796-240144818 GGGGGCTGGGGTGGGAGTGGAGG - Intergenic
948765376 2:240216643-240216665 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765427 2:240216750-240216772 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765451 2:240216802-240216824 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765496 2:240216906-240216928 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
1168756766 20:324168-324190 GGGGGGCGGGGTGGGGGTGGTGG - Intergenic
1168806563 20:675428-675450 GGGCGGGGGGTTGGGAGAAGAGG - Intronic
1168876161 20:1173701-1173723 GGGCAGGGGGAAGGGTGTGGAGG + Intronic
1168878088 20:1185071-1185093 GGGCCGGGGGCGGGGAGTGGCGG - Intronic
1168948219 20:1778744-1778766 GGTGGGCGGGATAGAAGTGGAGG + Intergenic
1169023441 20:2347878-2347900 GGGCAGTGGGATGGAAGTGGGGG + Intergenic
1169068959 20:2709911-2709933 GGGGGGTGGGAAGGGAGGGGAGG + Intronic
1169131520 20:3168342-3168364 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1169348055 20:4844853-4844875 GGGAGGGGGGAGGGGAGGGGGGG + Intergenic
1170160719 20:13307564-13307586 GGACGGGGGCATGGGAGTGCTGG - Intergenic
1170864711 20:20142976-20142998 GGGTGGGGGGATGGGCCTGGGGG + Intronic
1171767876 20:29300266-29300288 GGGCGGTGGGAGGGGGGCGGTGG + Intergenic
1171866012 20:30488083-30488105 GGGTGGTGGGAGGGGGGTGGTGG + Intergenic
1171875412 20:30570630-30570652 GGGTGTGGGGATGGGGGTGGGGG + Intergenic
1172013696 20:31861127-31861149 AGGCGGCGGGAGGGGAGGGAGGG - Exonic
1172039958 20:32036829-32036851 GGACGGCGGGCAGGGAGTGGGGG - Intergenic
1172194564 20:33083234-33083256 GGGCTGCTGGGTGGCAGTGGTGG + Intronic
1172194581 20:33083282-33083304 GGGCTGCTGGGTGGCAGTGGTGG + Intronic
1172320947 20:33994484-33994506 GGGCGGAGGGAGGGGAACGGAGG + Intronic
1172623179 20:36332794-36332816 GGGGGCTGGGATGGGAGGGGAGG - Intronic
1172772050 20:37387548-37387570 TGGCGGGGGGGTGGGAGGGGGGG + Intronic
1172848419 20:37944171-37944193 GGGCGGCGGGGCGGGCGCGGCGG - Exonic
1173352471 20:42257638-42257660 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1173427859 20:42958326-42958348 GGGAGGAGGGAGGGGAGAGGAGG + Intronic
1173737755 20:45373767-45373789 GGGCCTCGGGGTGGGGGTGGGGG + Exonic
1173741472 20:45405666-45405688 GGGTGCGGGGAGGGGAGTGGGGG - Intronic
1173767791 20:45629914-45629936 GGGCTGCTGGATGGGTGAGGGGG + Intronic
1173839972 20:46150923-46150945 GGGTGGGGGTATGGGAGTGGAGG + Intergenic
1173846402 20:46191415-46191437 GGGCGTGGGGATGGGGATGGGGG + Intronic
1174022397 20:47541400-47541422 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1174595734 20:51681978-51682000 GGGCAGCTAGAAGGGAGTGGAGG + Intronic
1174764066 20:53235134-53235156 GGGCGGGGGGGGGGGAATGGGGG + Intronic
1174840806 20:53899593-53899615 GGGTGGGGGGATGGGTGAGGGGG + Intergenic
1175050020 20:56146671-56146693 GGGGGGAGGGGTGGGGGTGGAGG - Intergenic
1175210464 20:57350895-57350917 GGGCGGGGGGACGGGGGCGGGGG + Intergenic
1175223572 20:57431978-57432000 GGGCAGCGGGTCGGGGGTGGGGG + Intergenic
1175278583 20:57788021-57788043 GGAGGGTGGGATGGGAGGGGTGG + Intergenic
1175336245 20:58198226-58198248 GGGCTGCAGGATGGGCGGGGAGG + Intergenic
1175360621 20:58408892-58408914 GGGGGGCGGGGTGGGGGGGGGGG - Intronic
1175490584 20:59378291-59378313 GGGTAGCGGGCTGGGGGTGGAGG + Intergenic
1175540296 20:59743905-59743927 GGGCAGCAGGAGGTGAGTGGAGG - Intronic
1175715726 20:61253133-61253155 GGGCGGCGGGGTAGGACTGCGGG + Intronic
1175831025 20:61965676-61965698 GGGCAACGGGATGTGAGTGGGGG - Intronic
1176005800 20:62861716-62861738 GGGCGGCGGGAGGCGGGAGGCGG + Exonic
1176018940 20:62952906-62952928 GGGAGGGGGGGTGGGAGCGGTGG + Intronic
1176038045 20:63049901-63049923 GGGCGGAGGGGAGGGGGTGGAGG - Intergenic
1176085592 20:63294153-63294175 GTGCGGGGGGAGGGGAGTGCGGG + Intronic
1176162104 20:63653277-63653299 GGGCGGCGGGATCTGAGCAGAGG - Intronic
1176232174 20:64038257-64038279 GGAAGGCGGGGTGGGGGTGGGGG - Intronic
1176270468 20:64233345-64233367 GGGCAGAGGGAAGGGAGGGGAGG - Intronic
1176306798 21:5127995-5128017 GGGCGGCGGGAGTTGACTGGGGG + Intronic
1177770046 21:25504047-25504069 GGCAGGAGGCATGGGAGTGGTGG - Intergenic
1177792449 21:25735392-25735414 GGGAGGCGGGAGGGGGGTTGGGG + Intronic
1178466191 21:32850197-32850219 GGGGGGCGGGAGGGGAGGAGGGG + Intergenic
1178615574 21:34130109-34130131 GGGTGGGGGGATGGGGGAGGGGG - Intronic
1178928084 21:36792457-36792479 GGGGGGAGGGAAGGGAGAGGGGG + Intronic
1179371189 21:40807455-40807477 GTGGGGCGGGATGGGGGTGGAGG + Intronic
1179466820 21:41581421-41581443 GGGCGGCGGGCGGGGTGTGGAGG - Intergenic
1179595023 21:42437639-42437661 GGGGAGTGGGAAGGGAGTGGAGG + Intronic
1179603326 21:42495882-42495904 GGGAGGCAGGATGGGGGTGGGGG + Intronic
1179810187 21:43865186-43865208 GGGCGGCGGGATGGGGGCCGGGG + Intronic
1179850259 21:44134035-44134057 GGGCGGCGGGAGTTGACTGGGGG - Intronic
1179937323 21:44613752-44613774 GGGTGGAGGGATGGGATGGGGGG + Intronic
1180081890 21:45490885-45490907 GGGCGGGTGGATGGGGATGGGGG + Intronic
1180094743 21:45550820-45550842 GGGAGGGGAGATGGGTGTGGAGG - Intergenic
1180156648 21:45981587-45981609 GCGGGGCGGGAGGGGAGGGGCGG - Intergenic
1180156659 21:45981606-45981628 GAGGGGCGGGAGGGGAGGGGCGG - Intergenic
1180156697 21:45981678-45981700 GAGGGGCGGGAGGGGAGGGGAGG - Intergenic
1180156708 21:45981697-45981719 GAGGGGCGGGAGGGGAGGGGAGG - Intergenic
1180312721 22:11252957-11252979 GGGTGGTGGGAGGGGGGTGGTGG + Intergenic
1181000886 22:19987275-19987297 GGGGGCCGGGGTGGGCGTGGCGG + Intronic
1181498107 22:23299499-23299521 GGGGGACGTGATGGGAGTTGGGG - Intronic
1181528508 22:23502931-23502953 GGATGGAGGGATGGGAATGGTGG - Intergenic
1181532338 22:23523944-23523966 TGGGGGTGGGATGGGGGTGGCGG - Intergenic
1181544212 22:23591922-23591944 GGGCTGGGGGAGGGGTGTGGAGG + Intergenic
1181586447 22:23855351-23855373 GGGAGGCGGGGTGGGGGGGGGGG + Intergenic
1181646374 22:24233457-24233479 GGCCTGGGGGGTGGGAGTGGGGG + Intronic
1181662637 22:24363925-24363947 GGGGGTGGGGGTGGGAGTGGGGG + Intronic
1181876793 22:25946004-25946026 GGGAGGTGGGAGGGGAGGGGAGG - Intronic
1181876802 22:25946021-25946043 GGGAGGTGGGAGGGGAGGGGAGG - Intronic
1181958386 22:26604946-26604968 GGGAGGCAAGATGGGAGGGGAGG - Intronic
1182103322 22:27672137-27672159 GGGGAGGGGGAGGGGAGTGGGGG + Intergenic
1182243157 22:28933707-28933729 GGGGGGTGGGGTGGGGGTGGGGG - Intronic
1182250658 22:28997400-28997422 GGGTTGGGGGGTGGGAGTGGGGG + Intronic
1182257052 22:29046788-29046810 GGGCGCCGGGAGGGGAGCTGTGG + Exonic
1182616210 22:31591753-31591775 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
1182679828 22:32070215-32070237 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1182686858 22:32127995-32128017 GAGGGGAGGGCTGGGAGTGGTGG - Intergenic
1183064182 22:35352424-35352446 GGGCAGGGGGCAGGGAGTGGAGG - Intergenic
1183221400 22:36515896-36515918 GGGGGGCGGATTGGGAGGGGTGG + Intronic
1183290590 22:36999561-36999583 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1183290601 22:36999579-36999601 GGAGGGGGGGATGGGAGGGGAGG + Intronic
1183301823 22:37062482-37062504 GGGCAGGAGGATGGGAGGGGCGG - Intronic
1183382854 22:37499069-37499091 GGGTGGCGGGAGCGGGGTGGGGG - Intronic
1183409854 22:37648441-37648463 GGGCCGCGGGCTGGGGGAGGTGG + Intronic
1183517146 22:38273106-38273128 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183517155 22:38273126-38273148 GGGCGGCGGGCTGGGGTTCGGGG - Intergenic
1183720180 22:39557888-39557910 GGGCGGCGGGCGGGGGGCGGCGG - Intergenic
1184131625 22:42519869-42519891 GGGAGGCGGGCTTGGAGTGAGGG - Intergenic
1184210867 22:43034915-43034937 GGGAGGGGGGAGGGGAGGGGTGG + Intergenic
1184226642 22:43132610-43132632 GGGGGGCAGGCTGGGGGTGGTGG + Exonic
1184287370 22:43479120-43479142 GGCCGGCGCCAGGGGAGTGGAGG - Intronic
1184315163 22:43682143-43682165 TGGTGGGGGGATGGGAGGGGAGG + Intronic
1184397039 22:44248455-44248477 GGGCAGCGGGGCAGGAGTGGGGG + Exonic
1184408694 22:44314190-44314212 GGGCGGTGGGGCGGGGGTGGGGG + Intergenic
1184755833 22:46515225-46515247 TGGCTGTGGGCTGGGAGTGGTGG - Intronic
1184799928 22:46753039-46753061 GGGCCTGGGGATGGGGGTGGGGG - Intergenic
1185037000 22:48484679-48484701 GGGGGAGGGGAGGGGAGTGGGGG - Intergenic
1185255280 22:49828014-49828036 GGGGACCGGGCTGGGAGTGGGGG + Intergenic
1185255406 22:49828352-49828374 GGGGGACGGGCCGGGAGTGGGGG + Intergenic
1185259544 22:49853879-49853901 GGGCCGCGGGAGGGGCGCGGGGG + Exonic
1185272574 22:49935789-49935811 GGGCGGAGGGGAGGGTGTGGGGG + Intergenic
1185397850 22:50601542-50601564 GGGAGGCGGGGTGGGAGGGGTGG + Intronic
1185408891 22:50672670-50672692 AGGGGGCAGGATGGGAGGGGTGG - Intergenic
949552405 3:5122257-5122279 CGGCGCCGGGACGGGCGTGGGGG + Exonic
949946704 3:9195383-9195405 GGCTGGCAGGGTGGGAGTGGGGG - Intronic
949987275 3:9551336-9551358 GGGCCAGGGGATGGGAGGGGTGG - Intronic
950321851 3:12063067-12063089 GGGGGGAAGGATGGGAGGGGAGG + Intronic
950522803 3:13506602-13506624 GGGGGGTGGGGTGGGGGTGGGGG + Intergenic
950536344 3:13581205-13581227 GGGCGGCAGGTGGGGGGTGGGGG + Intronic
950683988 3:14603214-14603236 CGGGGGCGGGATGGCGGTGGGGG + Intergenic
950722183 3:14891297-14891319 GGGCGGCTGGATGGAGGTGGTGG - Intronic
951553339 3:23896684-23896706 GGGTGGGTGGATGGGTGTGGTGG + Intronic
951611698 3:24496891-24496913 GGGGGGCGGGAGGGGGTTGGGGG + Intergenic
952155819 3:30642297-30642319 TGGTGGTGGGGTGGGAGTGGGGG + Intronic
952241187 3:31532828-31532850 GGCCGGCGGACTGGGGGTGGAGG - Exonic
952747221 3:36792640-36792662 GGCTGGCGGGGTGGGGGTGGTGG - Intergenic
952767752 3:36969690-36969712 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
952867310 3:37862348-37862370 GGGCGCCGGCATGGGCCTGGGGG + Intronic
952899429 3:38099769-38099791 CGGGGGCGGGGTGGGGGTGGGGG + Intronic
952901558 3:38114903-38114925 GGGAGGAGGGCTGGGACTGGGGG - Intronic
953002660 3:38950058-38950080 GGGGGGGGGGGTGGGGGTGGGGG - Intronic
953013100 3:39047033-39047055 GGGTGGGGGGATGGGGGTGGGGG - Intergenic
953246766 3:41199951-41199973 GGCAGGCGGGGTGGGGGTGGGGG + Intronic
953449184 3:42991988-42992010 GGGCAGAGGGGTGGGGGTGGGGG - Intronic
953614417 3:44477553-44477575 GGGCGCGGGGGTGGGGGTGGCGG - Intronic
953908841 3:46882063-46882085 CGGCGGCGGGATGTGAGTGCTGG - Intronic
953974388 3:47371384-47371406 CGGCGGCGGGGTGGGGGTGGGGG - Intergenic
954119844 3:48491061-48491083 GGGCGGGGGGTTGGGAGGGTGGG - Intronic
954292264 3:49655890-49655912 GGTGGGCGGCATGGCAGTGGTGG + Exonic
954315405 3:49798780-49798802 GGGTGACAGGATGGGGGTGGGGG - Intronic
954411467 3:50373007-50373029 GGGCGTGAGGATGGGAGGGGTGG + Intronic
954558379 3:51536034-51536056 GGGCCAGGGGATGGGGGTGGGGG + Intergenic
954632494 3:52055142-52055164 GGCGGGCGGGAGGGGAGGGGAGG - Intronic
955060472 3:55488318-55488340 GGGCTGGGGGGTGGGAGGGGGGG - Intronic
955531686 3:59879914-59879936 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
955554243 3:60118768-60118790 GGGCGGCGGGGGGGGGGGGGTGG + Intronic
955699787 3:61671874-61671896 GGGCGGCTGGATGGGCGGGGGGG + Intronic
955856497 3:63278570-63278592 GGGCGGCTGGCTGGGAGCAGGGG + Intronic
955913727 3:63884944-63884966 GGGCAGTGGGCTGGGCGTGGTGG - Intronic
956379975 3:68654880-68654902 GGGCGGGGGGGTGGGGGGGGAGG + Intergenic
956420906 3:69085499-69085521 GGGCGGGGGCAGGGGGGTGGGGG - Intronic
956604893 3:71064620-71064642 TGGAGGCGGGGAGGGAGTGGAGG - Intronic
957193515 3:77039777-77039799 AGGAGGCGGGAGGGGAGGGGAGG - Intronic
958875659 3:99613780-99613802 GGGGGGCGGGTGGGGAGGGGTGG - Intergenic
959567599 3:107848611-107848633 GGGCGGCAGGGGTGGAGTGGAGG + Intergenic
960535283 3:118808751-118808773 GCGGGGCGGGGTGGGGGTGGGGG - Intergenic
960590897 3:119364225-119364247 GGGTGGGGGGATGGAGGTGGGGG + Intronic
960851043 3:122054931-122054953 GGGTGGGGGGATGGGAGATGGGG - Intergenic
961594565 3:128006518-128006540 GGGCGGGGGGAAGGGGGTGGTGG - Intergenic
961640305 3:128360720-128360742 GGGTGCTGGGGTGGGAGTGGAGG + Intronic
962072308 3:132044883-132044905 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
962072344 3:132044949-132044971 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
963751327 3:149182570-149182592 TGGGGTGGGGATGGGAGTGGGGG + Intronic
964002818 3:151796162-151796184 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
964002840 3:151796200-151796222 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
964665993 3:159172767-159172789 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
964726268 3:159817306-159817328 GGGTGGCGGGCTGCGGGTGGCGG + Intronic
966168941 3:177055543-177055565 GGGGGGCGGGGCGGGGGTGGGGG + Intronic
966874610 3:184314995-184315017 GGGCGGCGGGCCGGGAGCCGTGG - Intronic
967055311 3:185825051-185825073 GGGCGGAGGGCGGGGAGGGGGGG - Exonic
967330946 3:188288820-188288842 GGGCGGGGGGGTGGGGGTGGGGG - Intronic
967705019 3:192640059-192640081 GGGGCACGGGATGGGAATGGGGG + Intronic
967851036 3:194083019-194083041 GGCCGGCGGGCAGGAAGTGGGGG + Intergenic
968064513 3:195751139-195751161 GGGTGGGGGGCTGGGGGTGGGGG + Intronic
968250115 3:197201994-197202016 GGGTGGAGGGGTGGGAGGGGTGG + Intronic
968473160 4:791175-791197 GGGCGGGGGGCGGGGAGCGGGGG + Intronic
968817452 4:2829328-2829350 GGAAGGCAGGATGGGAGTGCTGG + Intronic
968912507 4:3483328-3483350 GGGGGGCTGGGTGGGAGCGGGGG + Intronic
969377767 4:6774298-6774320 CGGCGGAGGGAGGGGAATGGGGG + Intergenic
969413385 4:7043554-7043576 GGGCGGCGGGCGGCGAGCGGGGG + Exonic
969487493 4:7480490-7480512 GGGCAGCGTGCTGGGAGTGCAGG + Intronic
969583134 4:8076994-8077016 GGGCTGCAGGATGGGGGTTGGGG + Intronic
969583148 4:8077036-8077058 GGGCTGCAGGATGGGGGTTGGGG + Intronic
970444516 4:16112691-16112713 GGGAGGAGGGAGGGGAGGGGAGG + Intergenic
970686827 4:18577997-18578019 GGGTGGGGGGAGGGGAGGGGAGG - Intergenic
971287198 4:25302178-25302200 GGGCGGTGGGGTGGGATTGGGGG - Intergenic
971380666 4:26094407-26094429 GGGTGGTAGGATGGGAGTGGTGG + Intergenic
971490991 4:27211837-27211859 GAGCGGCGGGGTGGGGGGGGTGG + Intergenic
971966430 4:33562968-33562990 GGTGGGCGGGAAGGGGGTGGTGG - Intergenic
972427212 4:38944812-38944834 GGGTAGCGGGATGGGGGTGGGGG - Exonic
972770645 4:42194057-42194079 GGGCTGCGGGTTGGGTGAGGGGG - Intergenic
972871515 4:43305451-43305473 GGGAGGTGGGGTGGAAGTGGGGG + Intergenic
972933844 4:44106870-44106892 GTGAGGCGGGATGGGAGGGGAGG + Intergenic
973655663 4:53044894-53044916 GGGGGGGGGGTTGGGGGTGGAGG - Intronic
973952828 4:56035010-56035032 GGGTGATGGGCTGGGAGTGGTGG - Intergenic
974548959 4:63348638-63348660 GGCTGGGGGGATGGGGGTGGGGG + Intergenic
975308577 4:72877360-72877382 GGTTGGCGGGATGGGAGAGGGGG - Intergenic
975570847 4:75816248-75816270 GGGGGGAGGGCTGGGTGTGGTGG - Intergenic
976220965 4:82756653-82756675 GGACGGGGGGAGGGGGGTGGGGG - Intronic
976284219 4:83355633-83355655 GGGGGGCGGGGTGGGAGTGGTGG + Intergenic
977574608 4:98663005-98663027 AGGCGGCAGGAGGGGTGTGGAGG - Intergenic
977694461 4:99950481-99950503 AGGCGGAGGGATGGGAACGGGGG + Intergenic
978072720 4:104491884-104491906 GGGGGGAGGGAAGGGAGTGATGG + Exonic
978819888 4:112954204-112954226 GGAGGGAGGGATGGGAGGGGAGG - Intronic
979278073 4:118835740-118835762 GGCCGGCGGGATGGGGGAGCAGG - Intronic
979715488 4:123832356-123832378 GGGCGGAGGGGGGGGAGAGGGGG + Intergenic
980243516 4:130206923-130206945 GGGTGGGGGGAGGGGAGAGGAGG - Intergenic
981586554 4:146309461-146309483 GGGGAGAGGGATGGGAGTTGTGG + Intronic
981745641 4:148049844-148049866 GGGCGGGGGGCGGGGGGTGGTGG + Intronic
981938221 4:150256181-150256203 GGGCAGCGGGAGGAGGGTGGGGG - Exonic
981970511 4:150659735-150659757 GGGCGGCTGGCCGGGCGTGGGGG - Intronic
982157651 4:152536954-152536976 GGGCGGCGGGAAGGGAGGATTGG + Intergenic
982439396 4:155417529-155417551 GGGTGGGTGGGTGGGAGTGGGGG - Intergenic
983828210 4:172291719-172291741 GGGCAGGGGGAGGGGGGTGGCGG - Intronic
984639243 4:182144449-182144471 GGCCGGCGGGCGGGGAGAGGGGG + Intronic
984891588 4:184498781-184498803 GGGCGCAGGGAGGGGAGGGGTGG + Intergenic
985058982 4:186057859-186057881 GGGTGGCGGGAGGTGGGTGGCGG - Intergenic
985195479 4:187424275-187424297 GGGCGGTGGGAAGGGATCGGGGG - Intergenic
985268251 4:188170251-188170273 TGGGGGGGGGTTGGGAGTGGTGG + Intergenic
985451999 4:190067657-190067679 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985452984 4:190070954-190070976 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985453973 4:190074247-190074269 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985454961 4:190077540-190077562 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985455950 4:190080840-190080862 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985456933 4:190084134-190084156 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985457920 4:190087427-190087449 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985458909 4:190090727-190090749 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985463161 4:190173492-190173514 GGCCGGCGGGGTGGTGGTGGTGG - Intergenic
985504656 5:271960-271982 GGGCGGCGGCAGGGGACGGGAGG - Intronic
985714257 5:1446573-1446595 GGGGGCGGGGAGGGGAGTGGTGG - Intergenic
985782072 5:1876652-1876674 GGGCGGAGGGCTCGGGGTGGGGG + Intergenic
985896302 5:2751576-2751598 CGGCGGCGGGGTGGCGGTGGCGG + Exonic
986721486 5:10563993-10564015 GGCCCGCGGGATGGGGGCGGAGG - Intergenic
987201943 5:15586255-15586277 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
988519357 5:31931862-31931884 GGAGGGCTGGATGGGAGGGGAGG + Intronic
988714236 5:33809340-33809362 TGGGGGCGGGATGGGAGGAGTGG - Intronic
989261562 5:39424710-39424732 GGGCGGGGGGGTGAGAGAGGGGG + Intronic
989380874 5:40808367-40808389 AGGGGGCGGGTTGGGGGTGGTGG + Intergenic
989600042 5:43192439-43192461 GGGTGGCGGGGTGGGGGTGCTGG - Intronic
989976072 5:50588564-50588586 GGGGGGCGGGCAGGGAGGGGAGG + Intergenic
990365078 5:55062270-55062292 GGGCGGCAGGATGGGATGCGGGG - Intergenic
990407276 5:55503915-55503937 GGGGGGAGGAATGGGAGAGGAGG + Intronic
990909242 5:60837309-60837331 GGGGGGTGGGGGGGGAGTGGGGG + Intronic
991927069 5:71716039-71716061 GGGGTGAGGGATGGGAGAGGAGG + Intergenic
992374160 5:76172304-76172326 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
992374214 5:76172433-76172455 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
992469507 5:77042418-77042440 GGGCGGCTGGCTGGGCGGGGGGG + Intronic
992549139 5:77844915-77844937 GGACGGCGGGAGGGGGTTGGGGG - Intronic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
993526669 5:88973691-88973713 GGGAGGTGGGATGGGAGGGAGGG + Intergenic
996097214 5:119411628-119411650 GGGCGGGGGGTAGGGGGTGGGGG - Intergenic
996185270 5:120465590-120465612 GGGGGCCGGGCTGGGAGGGGTGG + Intronic
997335960 5:133109033-133109055 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
997336013 5:133109161-133109183 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
997450694 5:133980692-133980714 GGGCAGCAGGGTGGGAGGGGTGG - Intronic
998142954 5:139710042-139710064 GGGCGGGGGGATGGTAGCGGGGG + Intergenic
998157447 5:139795108-139795130 GGGAGGCGGGAGGTGAGGGGTGG - Intergenic
998353097 5:141513755-141513777 GGGCGGGGAGATGGGAGAGCAGG - Intergenic
998402732 5:141856308-141856330 GAGGGGCGGGGTGGGGGTGGAGG + Intronic
998964553 5:147525024-147525046 GTGCGGTGGGGTGGAAGTGGAGG + Intergenic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999261570 5:150241826-150241848 GGGAGAGGGGAGGGGAGTGGAGG - Intronic
999721509 5:154402219-154402241 GGGAAGAGGGATGGGAGGGGAGG - Intronic
999725052 5:154430232-154430254 GGGCTGTGGGCTGTGAGTGGAGG - Intergenic
1000130218 5:158289968-158289990 GGGTGGGTGGGTGGGAGTGGAGG + Intergenic
1000205184 5:159051434-159051456 GGGCGGCGGGGTGGGGGGGTGGG - Intronic
1000239713 5:159398210-159398232 GGAGGGTGGGATGGGCGTGGTGG + Intergenic
1000345738 5:160312291-160312313 GGGCGGCGGGGGAGGAGTTGGGG - Intronic
1001044977 5:168364667-168364689 GGGTGGAAGGATGAGAGTGGAGG + Intronic
1001266507 5:170278323-170278345 GGGGAGGGGGATGGGAGTGCAGG + Intronic
1001266551 5:170278414-170278436 GGCGGGGGGGATGGGAGTGCAGG + Intronic
1001266566 5:170278444-170278466 GGCTGGGGGGATGGGAGTGCAGG + Intronic
1001417463 5:171556002-171556024 GGGTGGCGGGAGAGGAGGGGAGG - Intergenic
1001503773 5:172260053-172260075 GTGCGGCGGGGAGGGGGTGGGGG - Intronic
1001605161 5:172954477-172954499 GGGCGGCGGGGGGGAAGTGGGGG + Intergenic
1001642759 5:173256753-173256775 GGAGGGCGGGAAGAGAGTGGAGG - Intergenic
1002105956 5:176879541-176879563 CGGCGGCGGGGTGGGTGAGGTGG + Intronic
1002195062 5:177497008-177497030 GGGGGGGGGGAGGGGAGGGGAGG + Intronic
1002196891 5:177506023-177506045 GGGAGGCGGGCTGGGCGCGGTGG - Intronic
1002467494 5:179414970-179414992 GGGTGGGGGGATGGCAGGGGAGG - Intergenic
1002642168 5:180635484-180635506 GGGTGGTGGGATGGAAGTGTGGG + Intronic
1002869259 6:1151153-1151175 GGGAGATGGGATGGGAGTGAAGG - Intergenic
1002926679 6:1609406-1609428 GGGCTGCGGGAGGGGAGAGGCGG + Intergenic
1003028122 6:2576684-2576706 GGGCGGTGGGGTGGGGGTTGGGG + Intergenic
1003269193 6:4592192-4592214 GTGCTGGGGGAAGGGAGTGGAGG + Intergenic
1003868712 6:10385103-10385125 GGGGCGCGGGCTGGGAGGGGTGG - Intergenic
1004658386 6:17686897-17686919 GGGAGGGGGGCGGGGAGTGGGGG + Intronic
1004863557 6:19832135-19832157 GGGGGGCGGGGTGGGTGAGGTGG - Intergenic
1005250078 6:23935281-23935303 GAGCCCAGGGATGGGAGTGGGGG + Intergenic
1005512122 6:26520854-26520876 GGGCGGGGGCGTGGGAGGGGCGG - Intergenic
1006000707 6:30962958-30962980 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1006076412 6:31535320-31535342 AGGCAGCGGGCGGGGAGTGGAGG + Intronic
1006174561 6:32114165-32114187 GGGCAGTGGGAGGGGTGTGGGGG + Intronic
1006180168 6:32149663-32149685 GGGCGGCGGGGGGAGAGTGGAGG + Exonic
1006283941 6:33078897-33078919 GGGCGGATGGATGGCAGAGGAGG + Intronic
1006614073 6:35312775-35312797 GAGGGGCAGGATGGGGGTGGAGG + Intronic
1006746051 6:36342745-36342767 GGGAGGAGGGATGGAAATGGTGG + Intergenic
1007110496 6:39310855-39310877 GGCCAGGGGGATGGGGGTGGGGG - Intronic
1007112382 6:39320374-39320396 GGGCTGCAGGCTGGCAGTGGGGG - Intronic
1007277881 6:40689054-40689076 TGGAGGCTGGATGGGAATGGTGG - Intergenic
1007444510 6:41895010-41895032 GGGCGGCGGGAGGCGAGAGCCGG - Intronic
1007656832 6:43455627-43455649 GGGGGGGGGGATGGGGGTGGGGG - Intronic
1007740767 6:44008240-44008262 GGGCTGGGGGCTGGGAGAGGGGG + Intergenic
1007807988 6:44465047-44465069 GGGCGAAGAGATGGGAGTCGTGG + Intergenic
1008551218 6:52633134-52633156 GGGTGGGGGGTGGGGAGTGGTGG + Intergenic
1008665199 6:53709372-53709394 GGGCGGGGGGAGGGGAGTTGGGG - Intergenic
1009808717 6:68635020-68635042 GAGCCGCGGGGTGGGAGAGGAGG - Intergenic
1009994119 6:70880076-70880098 GGGCGTGGGGGTGGGGGTGGGGG + Intronic
1011620596 6:89238971-89238993 TGGGGGCTGGATGAGAGTGGTGG - Intergenic
1012410130 6:98947648-98947670 GGGCCGCGGGCGGGGAGGGGCGG + Intronic
1013116729 6:107109160-107109182 GGGGGGCGGTCTGGGCGTGGTGG + Intronic
1013369170 6:109455284-109455306 GCGCGGCGGGCTGGGAACGGAGG - Intronic
1013814658 6:114083415-114083437 AGGAGACGGGATGGGAGTGGGGG + Intronic
1015496663 6:133889916-133889938 GCGCGCGGGGCTGGGAGTGGGGG + Intronic
1015843654 6:137496902-137496924 GGGCGGGGGGAGGGGAGGGAAGG + Intergenic
1015891756 6:137976776-137976798 GGGAGGCAGGATGGGAAAGGAGG - Intergenic
1016386847 6:143537313-143537335 TGGCGGCGGGGTGGGGGTGGGGG + Intronic
1017604995 6:156124215-156124237 GGGTGGGGGCATGGCAGTGGCGG + Intergenic
1017756255 6:157531933-157531955 GTTCTGCGGGATGGGCGTGGGGG + Intronic
1017830798 6:158127255-158127277 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1018240316 6:161767777-161767799 GGGTGTGGGGATGGGAGTGCAGG + Intronic
1018371016 6:163168402-163168424 GGGTTGCGGGTTGGGGGTGGGGG + Intronic
1018435083 6:163752113-163752135 GGGCGGCGCGTTGGGAGTGCAGG - Intergenic
1019168177 6:170112883-170112905 AGAAGGTGGGATGGGAGTGGGGG - Intergenic
1019405438 7:881331-881353 GTGGGGTGGGGTGGGAGTGGGGG - Intronic
1019446459 7:1074009-1074031 GGGTGGGGGGTTGGGAGTGACGG - Intronic
1019458730 7:1146215-1146237 GGGCGGCTGGCTGGGCGGGGGGG + Intergenic
1019714012 7:2530095-2530117 GTGGAGCGGGGTGGGAGTGGGGG + Intergenic
1019720235 7:2565387-2565409 GCACGGCTGGAAGGGAGTGGTGG + Intronic
1019891930 7:3954324-3954346 GGGAGGCAGGAGGGGAGGGGAGG - Intronic
1019891943 7:3954355-3954377 GGGAGGCAGGAGGGGAGGGGAGG - Intronic
1019891979 7:3954445-3954467 GGGAGGCAGGAGGGGAGGGGAGG - Intronic
1019892007 7:3954516-3954538 GGGAGGTGGGAGGGGAGAGGAGG - Intronic
1020007414 7:4789985-4790007 GGGAGGGGGGAGGGGAGAGGGGG - Intronic
1020243017 7:6410103-6410125 GTGCGGCGTGGTGGGTGTGGTGG - Intronic
1021106426 7:16644875-16644897 GGGCCGAGGGGTGGGTGTGGAGG + Intronic
1021761227 7:23904762-23904784 GGGCGGGGGGATTGGGGTGTTGG + Intergenic
1021872677 7:25019425-25019447 GGGCGGCTGGCTGGGCGGGGGGG - Intergenic
1022099645 7:27161523-27161545 TGGCGGCGGGGTGGGGGTGGGGG + Intergenic
1022410697 7:30136299-30136321 GGGAGTCGGGGTGGGAGGGGTGG + Intronic
1023337445 7:39185202-39185224 GGGTGGCGGGATGGGGGAGGGGG + Intronic
1023724047 7:43123800-43123822 GGGCTGTGGGCTGGGAGTGGAGG + Intronic
1023727422 7:43158659-43158681 GGGGGAGGGGATGGGATTGGAGG - Intronic
1024963559 7:55003240-55003262 GGGGGGGGGAATGGGAGGGGGGG - Intergenic
1025023105 7:55495403-55495425 TGGCGGCAGGATGGGAGGGAGGG - Intronic
1025106577 7:56175562-56175584 GGGCGGTGGGTGGGAAGTGGGGG + Intergenic
1026821568 7:73553115-73553137 GGGTGGTGGGGTGGGGGTGGGGG + Intronic
1026839286 7:73660234-73660256 GGACGGAGGGAGGGGAGGGGAGG - Intergenic
1026890429 7:73978716-73978738 GGGGGGCGGGGTGGGGATGGGGG - Intergenic
1026894131 7:74000283-74000305 GGGCGGCGGGTGGGGGGGGGCGG + Intergenic
1026968527 7:74454537-74454559 GGGCGCCGGGGTGGGAGCAGAGG + Intronic
1026984440 7:74546094-74546116 GGGCGGAGGGATGAGGGTGAGGG - Intronic
1027400253 7:77799068-77799090 GGTCGTCGGGATGGAGGTGGGGG + Intronic
1027410903 7:77916632-77916654 GGGGGGGTGGTTGGGAGTGGTGG - Intronic
1027476928 7:78643736-78643758 GGGGTGGGGGATGGGAATGGTGG + Intronic
1028086852 7:86645981-86646003 GGGCGGGGGGGTGGGGGTGGGGG + Intronic
1028485561 7:91353658-91353680 TGGCGGCGGGGTGGGGGAGGTGG + Intergenic
1028773728 7:94656249-94656271 GGGATGGGGGATGGGGGTGGGGG - Intergenic
1029628288 7:101734106-101734128 GAGAAGGGGGATGGGAGTGGCGG - Intergenic
1030014597 7:105206143-105206165 GGGTGGTGGGGTGGGGGTGGGGG - Intronic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031629728 7:124032550-124032572 GGGCGGCGGGGCGGGGGTCGCGG - Exonic
1032074507 7:128830208-128830230 GGGCGGCGGGACGGGGTTGAGGG - Intergenic
1032151307 7:129432610-129432632 GGGCGGGGGGCTGGGTGTGGGGG - Intergenic
1032192201 7:129771667-129771689 GGCAGGCAGGATGGGAGGGGTGG - Intergenic
1032274581 7:130442951-130442973 GGCCGGCGGGTGGGGAGCGGGGG + Intergenic
1032420776 7:131777430-131777452 AGGTGGCAGGCTGGGAGTGGGGG + Intergenic
1032824636 7:135557245-135557267 GGGCGGGGGGTGGGGAGGGGAGG + Intergenic
1033098827 7:138453608-138453630 GGGGGTGGGGGTGGGAGTGGAGG - Intergenic
1033354913 7:140591930-140591952 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1034435230 7:151060073-151060095 GGGGGGCCGGAGGGGAGGGGTGG - Intronic
1034461332 7:151199580-151199602 GGGCTGCTGTGTGGGAGTGGAGG - Intronic
1035389880 7:158497067-158497089 GGGCGCAGGGAAGGGAGAGGGGG - Intronic
1035414439 7:158671081-158671103 GGGCAGGGGGGTGGGGGTGGGGG + Intronic
1035414462 7:158671163-158671185 GGGCAGGGGGGTGGGGGTGGGGG + Intronic
1035600633 8:894909-894931 GGGTGGGGGGAGTGGAGTGGCGG + Intergenic
1035717031 8:1763291-1763313 GGGCGGCGGCATGGGGGCGGTGG - Intronic
1036213762 8:6863143-6863165 GGGAGGCTGGTGGGGAGTGGGGG + Intergenic
1036213771 8:6863163-6863185 GGGAGGCTGGTGGGGAGTGGGGG + Intergenic
1036392543 8:8336882-8336904 GGGTGTGGGGAGGGGAGTGGGGG - Intronic
1036460898 8:8951535-8951557 AGGAGAAGGGATGGGAGTGGTGG + Intergenic
1036561546 8:9903768-9903790 GGGTGGAGGGATGGGGGTGTGGG + Intergenic
1036659754 8:10700368-10700390 GGGGGGCGGGATAGGGGTGGGGG - Exonic
1036709081 8:11066887-11066909 GTGCTGGGGGATGGGAGTGTGGG - Intronic
1036723649 8:11200751-11200773 GGGCGGCGGGCTGGGCGCCGTGG - Exonic
1037150019 8:15626034-15626056 GGGAGGCTGGGTGGTAGTGGTGG + Intronic
1037600938 8:20393138-20393160 GTAAGGCGTGATGGGAGTGGTGG + Intergenic
1038333297 8:26626858-26626880 GGGCGGCGGAGTGGCAGTGCTGG - Intronic
1038515025 8:28180772-28180794 GGGAGGAGGGATTGGTGTGGTGG - Intronic
1039212991 8:35236537-35236559 AGGCGCCGGGAAGGGAGAGGAGG - Intronic
1039468067 8:37797584-37797606 GGGAGGCGAGACGGGAGGGGTGG + Intronic
1039882546 8:41634075-41634097 GGGAGGTGGGAGGGGAGGGGAGG - Intergenic
1040006894 8:42628512-42628534 GGGTGGAGGGAGGGGAGTTGAGG - Intergenic
1040093266 8:43419454-43419476 GGGCGGCTGGCTGGGTGGGGGGG + Intergenic
1041070894 8:54125679-54125701 GGGCGGCTGGCCGGGCGTGGGGG - Intergenic
1041166899 8:55101112-55101134 GGCCCGCGGGCGGGGAGTGGCGG - Intergenic
1042115117 8:65422858-65422880 GGCCCGGGGAATGGGAGTGGGGG - Intergenic
1042303847 8:67311624-67311646 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1042560522 8:70070005-70070027 GGCTGGCGGGATCGGACTGGGGG - Intronic
1042564578 8:70099087-70099109 GGGAGGGGGGAGGGGAGAGGAGG + Intergenic
1042905278 8:73766176-73766198 GGAAGGCGGGAAGGGAGAGGAGG + Intronic
1042995500 8:74693613-74693635 GGGGGGAGGGGTGGGAATGGTGG + Intronic
1043052974 8:75405140-75405162 GGGTGGGGGGATGGGGGTGGGGG + Intergenic
1043463857 8:80486552-80486574 GCGCGGCGGGGCGGGGGTGGAGG + Exonic
1043891204 8:85654403-85654425 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043892278 8:85661240-85661262 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043893283 8:85716100-85716122 GGGCTGCGGGAGGCGATTGGTGG - Intergenic
1043895966 8:85737549-85737571 GGGCTGCGGGAGGCGATTGGTGG - Intergenic
1043896713 8:85744259-85744281 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043899036 8:85762626-85762648 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043900647 8:85774820-85774842 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043902611 8:85790095-85790117 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043904221 8:85802288-85802310 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043905833 8:85814482-85814504 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1043907441 8:85826669-85826691 GGGCTGCGGGAGGCGATTGGTGG + Intergenic
1044660970 8:94591612-94591634 GGGCGGCTGGCTGGGTGGGGGGG - Intergenic
1045184159 8:99818981-99819003 GGGTAGGGAGATGGGAGTGGAGG + Intronic
1046046967 8:108976120-108976142 GGGAGGAGGGAGGGGAGGGGAGG - Intergenic
1046757745 8:117989241-117989263 AGGCAGTGGGATGGGGGTGGGGG - Intronic
1046766330 8:118074078-118074100 TGGGGGTGGGGTGGGAGTGGGGG + Intronic
1046846526 8:118922290-118922312 GGGAGGGGGGCGGGGAGTGGTGG - Intergenic
1047205917 8:122802942-122802964 GTGGGGTGGGGTGGGAGTGGGGG - Intronic
1047255411 8:123210007-123210029 GGTTGGTGGGGTGGGAGTGGGGG - Intronic
1047361324 8:124172002-124172024 GGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1047594701 8:126366497-126366519 GGGTGGCGGGGCGGGAGTGGCGG - Intergenic
1047747167 8:127853923-127853945 GGGCCACGGGATGGGGGCGGGGG - Intergenic
1047916811 8:129592241-129592263 AGGGGGCGGGGTGGGGGTGGGGG - Intergenic
1047962980 8:130024472-130024494 GGGGGGCGGGGTGGTGGTGGGGG - Intergenic
1048167478 8:132076421-132076443 GGGGTGGGGGATGGGAGGGGTGG - Intronic
1048295883 8:133212960-133212982 GGGCAGCGGGGTGGGGATGGCGG - Exonic
1049103604 8:140597469-140597491 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1049154665 8:141059401-141059423 TGGGGGCGGGCTGGGGGTGGAGG + Intergenic
1049216175 8:141409386-141409408 GGGCAGGGGGATGGGAGGGATGG + Intronic
1049222444 8:141434225-141434247 GGGCTGGGGAATGGGGGTGGTGG - Intergenic
1049258093 8:141624561-141624583 GGGAGGGGCCATGGGAGTGGTGG + Intergenic
1049265773 8:141667108-141667130 GGGAGGCAGGATGGGAGTGGGGG + Intergenic
1049271916 8:141700543-141700565 GAGAGGCGGGATGGGGGAGGGGG + Intergenic
1049440497 8:142607315-142607337 GTGGGGAGGGAGGGGAGTGGAGG + Intergenic
1049610526 8:143552920-143552942 GGGCAGGGGTAGGGGAGTGGGGG + Intergenic
1051079573 9:13279264-13279286 GGGGGCGGGGATGGGGGTGGGGG - Intronic
1051406041 9:16738808-16738830 GGGCGGGAGGATGGGGGTGGGGG - Intronic
1051629551 9:19128890-19128912 GGGCCGGGGGGGGGGAGTGGGGG - Intronic
1053237731 9:36470767-36470789 GGGCTGCTGCATGGAAGTGGGGG - Intronic
1053344801 9:37370527-37370549 GGGCTGTGGCATGGGAGTGAGGG + Intergenic
1053560460 9:39188459-39188481 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1053682082 9:40492279-40492301 AGGTGGCGGGGTGGGACTGGAGG + Intergenic
1053824563 9:42008701-42008723 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1053932069 9:43120605-43120627 AGGTGGCGGGGTGGGACTGGAGG + Intergenic
1054136658 9:61430496-61430518 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1054281631 9:63132653-63132675 AGGTGGCGGGGTGGGACTGGAGG - Intergenic
1054295179 9:63327776-63327798 AGGTGGCGGGGTGGGACTGGAGG + Intergenic
1054393199 9:64632282-64632304 AGGTGGCGGGGTGGGACTGGAGG + Intergenic
1054427848 9:65137492-65137514 AGGTGGCGGGGTGGGACTGGAGG + Intergenic
1054489413 9:65762585-65762607 CGGCGGCGGGGGGGGGGTGGGGG - Intergenic
1054502528 9:65884046-65884068 AGGTGGCGGGGTGGGACTGGAGG - Intronic
1054606008 9:67178662-67178684 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1054708613 9:68488237-68488259 GTGCTGGGGGATGGGAGAGGGGG - Intronic
1054790390 9:69251198-69251220 TTGAGGAGGGATGGGAGTGGAGG - Exonic
1055010115 9:71556084-71556106 GGGCAGGGGGGTGGGGGTGGTGG - Intergenic
1055018032 9:71640199-71640221 GGGTGGTGGGCTGGGTGTGGTGG - Intergenic
1055059398 9:72053150-72053172 GGGCGGCAGGGTGGGGTTGGAGG + Intronic
1055137436 9:72841310-72841332 GGGCGGCTGGCCGGGTGTGGGGG + Intergenic
1055441883 9:76344576-76344598 TGGGGGTGGGATGGGAGTGGTGG + Intronic
1056102434 9:83312737-83312759 GGGCGGCGGAGGGGGAGTGGTGG - Intronic
1056965353 9:91160164-91160186 GCGCCGCGGGGTGGGGGTGGGGG - Intergenic
1057040602 9:91844881-91844903 GGGCGGGGGGAAGGGGGTGCGGG + Intronic
1057182549 9:93037881-93037903 GGGCTGTGGGATGGGAGGGCTGG - Intergenic
1057239138 9:93392918-93392940 TGGCAGGGGGATGGGGGTGGGGG - Intergenic
1057259591 9:93576441-93576463 GGGCGGCGGGCGGGGAGCCGCGG - Exonic
1057704954 9:97389582-97389604 GGCAGGCGGGGTGGGGGTGGGGG - Intergenic
1057767442 9:97934448-97934470 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1057887388 9:98840239-98840261 GGGCAGGCGGGTGGGAGTGGAGG - Intronic
1057988684 9:99744661-99744683 GGGTGGTGGGATGGGGCTGGGGG - Intergenic
1059115755 9:111599201-111599223 GGGCGGCGGGAGGCGAGGGTGGG - Intronic
1059211267 9:112514866-112514888 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1059424005 9:114209579-114209601 GGGATGTGGGATGGCAGTGGTGG + Intronic
1059596907 9:115730749-115730771 GGGCGGGGAGATGGCAGGGGAGG - Intergenic
1060065261 9:120496394-120496416 GGGCGGCTGGCTGGGCGGGGGGG - Intronic
1060376655 9:123120479-123120501 GGGCGGGGGGGTGGGGGGGGGGG + Intronic
1060614147 9:124996203-124996225 GGGCGGTGGGGCGGGGGTGGGGG + Intronic
1060687415 9:125624445-125624467 GGGCGGCTGGCCGGGCGTGGGGG - Intronic
1060781261 9:126415015-126415037 GAGAGGCCGGCTGGGAGTGGGGG - Intronic
1060803297 9:126558088-126558110 GGGGGGGGGGAGGGGAATGGGGG - Intergenic
1060831882 9:126722545-126722567 GGGCGGTGGGAGGGGACTGCTGG - Intergenic
1060855801 9:126914566-126914588 GGGCGGCGGGCCGGGTGTGCTGG + Intergenic
1060974309 9:127755380-127755402 GGGCGAGGGGCTGGGAGCGGGGG - Intronic
1061059891 9:128245044-128245066 GGCCGGCAGGAAGGGAGGGGTGG + Intronic
1061079429 9:128361165-128361187 GGGAGGAGGAATGGGAGAGGGGG + Exonic
1061348208 9:130043232-130043254 GAGGGGCGGGAGGGGAGGGGCGG + Intergenic
1061519708 9:131110929-131110951 AGGCGGAGGGGTGGGAGCGGGGG + Intronic
1061584611 9:131557878-131557900 GGCAGGCGTGATGGCAGTGGCGG - Intergenic
1061800654 9:133111921-133111943 GGGGGTCGGGAAGGGAGTGAAGG + Intronic
1061893135 9:133633298-133633320 GGGGGTGGGGATGGGAATGGGGG - Intergenic
1061916795 9:133759706-133759728 GGGCGGAGCGAGGGGAGGGGCGG + Intergenic
1062074234 9:134575759-134575781 GGGCTGTGGGATGCTAGTGGGGG - Intergenic
1062298376 9:135847883-135847905 GAGTGGGGGGAGGGGAGTGGGGG + Intronic
1062298398 9:135847929-135847951 GAGTGGGGAGATGGGAGTGGGGG + Intronic
1062345822 9:136114728-136114750 GGGAGGCGGGAGGGGGCTGGTGG - Exonic
1062353182 9:136148978-136149000 GGACGGCGGGGTGGGAAAGGTGG + Intergenic
1062556214 9:137114417-137114439 GGGCGGCGGGACGGCGGGGGCGG + Intronic
1062577475 9:137215377-137215399 GGACGGCGGGGTGGGGGTGGTGG - Intronic
1062628475 9:137453438-137453460 GGGCGCCTGGGAGGGAGTGGGGG + Intronic
1062656213 9:137605578-137605600 GAGGGGCCGGATGGGGGTGGAGG + Intergenic
1203767968 EBV:36393-36415 GGGGGGGGTGGTGGGAGTGGTGG - Intergenic
1203361222 Un_KI270442v1:220436-220458 GTGCGGTGGGAGGGGGGTGGTGG + Intergenic
1203363500 Un_KI270442v1:237862-237884 GGGCGGCGGGATGTGAAGGGGGG + Intergenic
1185459484 X:328236-328258 GGGCGGGGAGAGGGGAGGGGGGG - Intergenic
1185459496 X:328256-328278 GGGCGGGGAGAGGGGAGGGGGGG - Intergenic
1185459821 X:328850-328872 GGGAGGGGGGAGGGGAGAGGTGG - Intergenic
1185462766 X:340174-340196 GGGGGGCGGGGTGAGAGGGGAGG + Intronic
1185502462 X:608394-608416 GGGGAGGGGGATGGGAGGGGAGG - Intergenic
1185621741 X:1454093-1454115 GGGCGGGGAGATGGGTGGGGGGG + Intergenic
1186152803 X:6692996-6693018 GGGGTGGGGGATGGGAGGGGTGG + Intergenic
1186802803 X:13110599-13110621 GGGCGGAGGGGCGGGGGTGGGGG - Intergenic
1187035220 X:15531560-15531582 GGGCAGTGGGGTGAGAGTGGTGG - Intronic
1187332646 X:18354714-18354736 GGGGGGCGGGGCGGCAGTGGCGG - Exonic
1187405655 X:19001321-19001343 GGGCGGTGGCATGGGGCTGGCGG - Intronic
1187937178 X:24347328-24347350 CGGAGGCGGGGTGGGGGTGGGGG - Intergenic
1187993941 X:24905415-24905437 GGGTGGGGGGGTGGGGGTGGGGG + Intronic
1188008451 X:25034495-25034517 GGGGGGCGGGTGGGGGGTGGGGG + Intergenic
1188069048 X:25696196-25696218 GGGCGGGGGGGTGGGGGGGGGGG + Intergenic
1189197825 X:39166744-39166766 GTGGGATGGGATGGGAGTGGGGG - Intergenic
1189244900 X:39555755-39555777 GGGTGGCAGCATGGGAGGGGTGG + Intergenic
1189252648 X:39613316-39613338 GGGAGGTTGGATGGGAGGGGAGG + Intergenic
1189330947 X:40144973-40144995 GGGCGGGGGGAGGGGGGTTGAGG - Intronic
1189473929 X:41334645-41334667 GCGCGGCGGGACGCGACTGGAGG + Intronic
1189757053 X:44282644-44282666 GGGTGGGGGGGTGGGAGAGGAGG + Intronic
1189821884 X:44876618-44876640 GGCCGGGGGGTTGGGGGTGGGGG - Intronic
1189823979 X:44898530-44898552 GGGAGGTGGGAGTGGAGTGGTGG + Intronic
1190109282 X:47579525-47579547 GGGGAGCTGGATGGGTGTGGGGG - Intronic
1190149925 X:47936826-47936848 GGGCGGGGGGAGGGGTGCGGCGG + Intronic
1190856567 X:54300953-54300975 GGGAGGCAGGTTGGGCGTGGTGG + Intronic
1190868106 X:54401598-54401620 GGGAGGGGGGTTGGGAGGGGAGG - Intergenic
1191085569 X:56563901-56563923 GGGCCGCGGGAGGGGCGCGGGGG - Exonic
1192779918 X:74283503-74283525 GGGTGGGGGGAAGGGAATGGTGG - Intergenic
1192803974 X:74493876-74493898 GGCTGGGGGGATGGGAATGGGGG - Intronic
1193221771 X:78934980-78935002 GGGCTGCGGGAGGGGGTTGGGGG + Intergenic
1193550470 X:82886409-82886431 GGGCGGCGGGGGAGGTGTGGTGG - Intergenic
1193864141 X:86708635-86708657 GGAGGGTGGGAAGGGAGTGGGGG + Intronic
1193969963 X:88039127-88039149 GGGCGGGGGGCGGGGGGTGGGGG - Intergenic
1194158073 X:90417937-90417959 GGGAAGCAGGATGGGCGTGGTGG + Intergenic
1195068465 X:101258169-101258191 GGGGGTGGGGATGGGGGTGGGGG + Intronic
1195158093 X:102142555-102142577 GGTGGGCGGGAAGGGGGTGGTGG - Intronic
1196507430 X:116463732-116463754 GGGCGGCGGGATCGGTGGGGAGG - Intergenic
1196542917 X:116930612-116930634 GGGGGGCGGGAAGGGAGAGAGGG + Intergenic
1196871336 X:120116041-120116063 GGGGTGCGGGTGGGGAGTGGGGG + Intergenic
1197862196 X:130982889-130982911 GGCAGTAGGGATGGGAGTGGGGG - Intergenic
1197935637 X:131737322-131737344 GGGCGGGGGGAGGGGGGCGGTGG + Intergenic
1198051477 X:132956744-132956766 GGGCGGAGGGCTGGGAGGCGCGG - Intronic
1198517569 X:137425044-137425066 GGGCGGGGGGCGGGGAGAGGGGG + Intergenic
1198807076 X:140503657-140503679 GGGGTGCGGGGCGGGAGTGGGGG + Exonic
1198870888 X:141176518-141176540 GGGCTGCGGGGAGGGGGTGGCGG + Exonic
1199736712 X:150692921-150692943 GGGCGGCGGGGTGCGTATGGAGG + Intergenic
1199865652 X:151847799-151847821 TGGCGTGGGGGTGGGAGTGGGGG + Intergenic
1199872729 X:151913228-151913250 GGGTTGCGGGATGGGAATAGCGG - Intronic
1199874298 X:151919292-151919314 GGGGTGGGGGATGGGAATGGGGG - Intronic
1199874475 X:151919977-151919999 GGGAAGGGGGATGGGAATGGGGG - Intronic
1199894806 X:152118793-152118815 GGGGTGGGGGATGGGAATGGGGG + Intergenic
1200003114 X:153072220-153072242 CCGCGGCGCGAGGGGAGTGGGGG + Intergenic
1200004609 X:153077789-153077811 CCGCGGCGCGAGGGGAGTGGGGG - Intergenic
1200017696 X:153179171-153179193 GGGCGTGGGGGTGGGGGTGGGGG - Intergenic
1200218342 X:154378664-154378686 GTGCGGCGGGGTGAGAGGGGCGG - Intergenic
1200233892 X:154459159-154459181 GGGAGGCGGGGGGGGAGCGGGGG - Intronic
1200487545 Y:3787037-3787059 GGGCGGGGGGGTGGGGGGGGAGG + Intergenic
1200969454 Y:9135188-9135210 GGGGGGAGGGATGGCAATGGGGG + Intergenic
1200974742 Y:9196626-9196648 GGGGGGAGGGATGGCAATGGGGG + Intergenic
1201017966 Y:9624350-9624372 GGGAGGAGGCATGGCAGTGGGGG + Intergenic
1201074809 Y:10178976-10178998 GGGTGGCGGGATGTGAAGGGGGG - Intergenic
1201077224 Y:10197124-10197146 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1201140463 Y:11023276-11023298 GGGCGGGGGGGTGGGGGGGGAGG - Intergenic
1201270894 Y:12252743-12252765 GGGTGGGGGGATGGAAGTGGCGG - Intergenic