ID: 901846932

View in Genome Browser
Species Human (GRCh38)
Location 1:11989249-11989271
Sequence CAGTGACAAAGTGCTTAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901846932_901846936 13 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846936 1:11989285-11989307 CAATGGCATTTTTGAGCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 205
901846932_901846940 28 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846940 1:11989300-11989322 GCAGCTGGGGGCCTACATCCAGG 0: 1
1: 0
2: 1
3: 23
4: 184
901846932_901846937 14 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846937 1:11989286-11989308 AATGGCATTTTTGAGCAGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 192
901846932_901846939 16 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846939 1:11989288-11989310 TGGCATTTTTGAGCAGCTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 230
901846932_901846938 15 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846938 1:11989287-11989309 ATGGCATTTTTGAGCAGCTGGGG 0: 1
1: 0
2: 2
3: 25
4: 231
901846932_901846934 -4 Left 901846932 1:11989249-11989271 CCCACTTAAGCACTTTGTCACTG 0: 1
1: 0
2: 0
3: 8
4: 120
Right 901846934 1:11989268-11989290 ACTGCCAAGAAGAAGATCAATGG 0: 1
1: 0
2: 0
3: 9
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901846932 Original CRISPR CAGTGACAAAGTGCTTAAGT GGG (reversed) Exonic
901846932 1:11989249-11989271 CAGTGACAAAGTGCTTAAGTGGG - Exonic
905851387 1:41277634-41277656 CAGTAACACAGGCCTTAAGTGGG - Intergenic
912031608 1:105252569-105252591 CAGTGAAAAAGAGCAGAAGTAGG - Intergenic
915250708 1:154586316-154586338 CAGTGACATTGTGCCTACGTGGG - Exonic
918920429 1:190702800-190702822 CATTTACAGAGTGCTTATGTGGG - Intergenic
919582706 1:199397549-199397571 AAGTGTCAAAGTGCCCAAGTTGG + Intergenic
922169740 1:223144226-223144248 GAGTGACAAATTGCCTAGGTAGG + Intergenic
923154947 1:231270044-231270066 CAGTGGCACACTGCTCAAGTTGG - Intronic
923937077 1:238774566-238774588 AAGTGACAAAGTGAATAAATTGG - Intergenic
924202018 1:241670419-241670441 CAGTGTCAAAGTTCTTAGCTGGG + Intronic
1065780650 10:29163564-29163586 AAGTGACTAAGTGCTTAACTTGG - Intergenic
1068067764 10:52153340-52153362 CAATGACAATGTGATTAATTGGG - Intronic
1068118670 10:52762140-52762162 CAGTGACAAAGTCCTGCTGTGGG + Intergenic
1070494755 10:77011304-77011326 CAGTGGCAAACTGCTTTAGAAGG + Intronic
1070832769 10:79430396-79430418 GAGTGACAAGGAGCTTAAGGAGG + Intronic
1073289786 10:102407878-102407900 CAGTGACAAAGTGTGCACGTGGG - Intronic
1074082843 10:110181479-110181501 CCCTGACAAAATGCTTAATTAGG + Intergenic
1074954459 10:118374653-118374675 CACTGACAAAATGCTTTAGAAGG + Intergenic
1075424810 10:122333230-122333252 CAGAGACATCGTGCCTAAGTGGG + Intronic
1075862761 10:125691383-125691405 TATTGACTAAGTGCTTAATTAGG - Intergenic
1078671767 11:13371961-13371983 CAGTGTCAGAATGCTTAAGTAGG - Intronic
1080362068 11:31527033-31527055 CAGTGAGAAAGTCATTAAGGTGG - Intronic
1082193678 11:49276486-49276508 TAGTGACAAAGTGGGTAACTGGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1086571904 11:88294729-88294751 CTATGGCAAAGTGGTTAAGTGGG + Intronic
1086672465 11:89564573-89564595 TAGTGACAAAGTGGGTAACTGGG + Intergenic
1087185255 11:95184698-95184720 CAGTTATGAAGTTCTTAAGTCGG + Intronic
1091136953 11:133200158-133200180 CAGGGAAAAAGTTCTCAAGTTGG - Intronic
1093104186 12:15066004-15066026 CAGAGACAAAATGCTTGGGTGGG + Intergenic
1093367702 12:18323863-18323885 CAAAAACAAAGTGCTGAAGTGGG + Intronic
1096745065 12:53721483-53721505 CAGTGAGAAAGTGCTGACGAAGG - Exonic
1097780521 12:63698206-63698228 CAGTGACTGAATGCTAAAGTTGG + Intergenic
1101718076 12:107328718-107328740 CAGCTACAAAGTGGTTGAGTTGG + Intronic
1102834690 12:116044222-116044244 CATTTGAAAAGTGCTTAAGTTGG - Intronic
1103365189 12:120377132-120377154 CAGTGAGAAAGTGAGAAAGTGGG - Intergenic
1106152420 13:27118544-27118566 CTGTGACAAAGTACTTGAGCTGG - Intronic
1107692109 13:42963860-42963882 GAGTGATAAAGGGCTTAGGTAGG + Intronic
1109530344 13:63635132-63635154 CAACTACAAAATGCTTAAGTGGG - Intergenic
1112866945 13:103914736-103914758 TAGGGACAAAGTGCTAAAATGGG - Intergenic
1115050920 14:29062025-29062047 AAGAGACAAACTGCTTAAGGAGG + Intergenic
1117428729 14:55629736-55629758 CAGTGGCAAAGTGTTTATGAAGG + Intronic
1125250822 15:37701145-37701167 CAGGGACAAAGTCCCAAAGTAGG - Intergenic
1125854612 15:42936913-42936935 CAGTAAGAAAGTGCTGCAGTGGG + Intergenic
1126163955 15:45638092-45638114 CATTGAGAAAGTGCTAAATTGGG + Intronic
1128487432 15:68108368-68108390 AAGTGACAAAGTGCACAAGCAGG - Intronic
1128760019 15:70210223-70210245 CAGTGACAAATTGCCTGAGCCGG - Intergenic
1134541954 16:15074900-15074922 CAATGTCAAAGTGGTTTAGTAGG + Intronic
1139302960 16:65961224-65961246 CAGTGAGCAAGTGCTTAGGCTGG - Intergenic
1149385615 17:56140609-56140631 CAGAAACAGAGAGCTTAAGTAGG - Intronic
1155216342 18:23646465-23646487 AAGTGACAAATTGCTGAGGTTGG + Intronic
1159070864 18:63622529-63622551 CAGATACAAAGTTCTTAAGGAGG + Intergenic
1159193369 18:65078836-65078858 CACTGTAAGAGTGCTTAAGTGGG - Intergenic
1165649451 19:37472899-37472921 CTGGAACAATGTGCTTAAGTAGG + Intronic
1166228192 19:41410470-41410492 CAGTGAGAAAGTGCTGGAGTTGG + Intronic
1167507574 19:49878919-49878941 CAGTGACGAAGTGGGTGAGTAGG - Intronic
1168477748 19:56689528-56689550 TAGTCACAAAATGCTTAAGATGG - Intergenic
1168478478 19:56696088-56696110 TAGTAACAAAATGCTTAAGATGG - Intergenic
926832627 2:16980070-16980092 CCCTGACAAAGTACTTAAGAAGG + Intergenic
927060381 2:19413050-19413072 CTGAGACAAATTGCATAAGTAGG + Intergenic
928117812 2:28560113-28560135 CAGTGGTTAAGTGCTTAAGAAGG - Intronic
930553027 2:52859847-52859869 CATTGTCAAAGTGGTTAAGGAGG - Intergenic
937518473 2:122682935-122682957 CAGTGACAAGGTGGTTGAGATGG - Intergenic
940943784 2:159593497-159593519 CAGTGAAAATGTGGATAAGTGGG - Intronic
945758288 2:213878019-213878041 CAAAGACAAAGTGCTTGTGTTGG - Intronic
946882406 2:224189773-224189795 CAGTTATAAAGTTCTTAAATGGG - Intergenic
948365360 2:237451175-237451197 AAGTGAAAAAGTGATAAAGTGGG - Intergenic
948556530 2:238815000-238815022 CATTGACACAGTGCTGGAGTGGG + Intergenic
1169766852 20:9155857-9155879 AAGTGAGAAAGAGCTAAAGTGGG - Intronic
1172454355 20:35055955-35055977 CATGGACAAAGTGCTTTATTTGG + Intronic
1178093551 21:29189832-29189854 CAGTGACATAGTTCTAGAGTAGG - Intergenic
1178127590 21:29532186-29532208 CATTGCCAAGGTGCTTAAGTAGG - Intronic
1179600543 21:42474729-42474751 CAGTGACGCAGTGCTGAGGTGGG - Intronic
1180666589 22:17517986-17518008 CAGTGTCAAAGCCCTTAACTGGG - Intronic
1182619218 22:31609535-31609557 AATTGACCAAGTGGTTAAGTTGG + Intronic
1183065976 22:35363028-35363050 CAGAAACAAATTGCTTAAGATGG - Intergenic
1184064293 22:42108025-42108047 CAGTGAAAAAGTATTTTAGTTGG + Intergenic
950215832 3:11158062-11158084 GAATGACAAATTGCTTAATTGGG + Intronic
951916554 3:27806753-27806775 CCGTGACAAATTGCTCAAGAGGG + Intergenic
952310452 3:32184379-32184401 AACTGACAAAGGGCTTAAATAGG + Intergenic
953187683 3:40653705-40653727 CAGTGAGAAAGGGCTCAAGGTGG + Intergenic
955460958 3:59182775-59182797 CAGTGAAATAGTGCAGAAGTGGG + Intergenic
963826247 3:149957350-149957372 CAGTCAAAAAGTGGTTAAATTGG - Intronic
964892223 3:161551149-161551171 CAGAGACTAAGTGGTTATGTAGG - Intergenic
971269881 4:25132612-25132634 CAGTGACAGAGTTCTCAAATGGG + Intronic
971688204 4:29798452-29798474 AAGTGAGAAAGTGATGAAGTTGG - Intergenic
971747005 4:30594942-30594964 CATTGACTGAGTTCTTAAGTTGG + Intergenic
971912392 4:32810740-32810762 AAGTGGCAAAGTGTTTAAGAGGG - Intergenic
976172024 4:82314047-82314069 AACTGACAAATTGCTTCAGTGGG + Intergenic
978002338 4:103571842-103571864 TACTGACTAAATGCTTAAGTTGG + Intergenic
978506714 4:109465597-109465619 AAGTCACAAAATCCTTAAGTTGG - Intronic
982587448 4:157260435-157260457 AAGGGACAAAGTGCTTCAGATGG - Intronic
987723980 5:21673354-21673376 TAGGGACAAAGTCCTTAGGTAGG - Intergenic
987839512 5:23205088-23205110 CTATTACAAATTGCTTAAGTTGG - Intergenic
990615928 5:57508351-57508373 CAGTGACATAGTCCTTTAGCTGG - Intergenic
997879868 5:137579952-137579974 CAGTGAGAAGGTGCTTATGTAGG + Intronic
1003492478 6:6635734-6635756 CAGTGACAAAGTGGCTGAGATGG + Intronic
1004778766 6:18881538-18881560 TAGGGATAAAATGCTTAAGTAGG - Intergenic
1007158468 6:39769588-39769610 CAGTTAACAAGTGCTGAAGTTGG + Intergenic
1010145357 6:72662691-72662713 CAGTGATTTAGTTCTTAAGTTGG - Intronic
1010731710 6:79398161-79398183 CAGTGGGAAAGTGCTTCAGTGGG + Intergenic
1011173191 6:84529289-84529311 CATTGAAAAGGTGCTTATGTGGG - Intergenic
1012001781 6:93663295-93663317 CAGTGCCAGAGTGCATAACTGGG + Intergenic
1013284714 6:108671329-108671351 CAGGGACAGTGTGCTGAAGTGGG - Intronic
1013303353 6:108824594-108824616 TAGTGACAGAGTGCTTTGGTTGG + Intergenic
1017847923 6:158275564-158275586 CAGTGACAAAGCGCTGCCGTGGG - Intronic
1019012753 6:168855260-168855282 CAGTCAAAAAGTTCTTAACTAGG - Intergenic
1022527605 7:31048618-31048640 CAGGGACAAAGGGCCTTAGTGGG + Intergenic
1022939099 7:35214257-35214279 CAGTGACTGAATGCTAAAGTCGG + Intronic
1027863016 7:83609398-83609420 CAGAGACAAAGTGATTGAGTTGG + Intronic
1030940436 7:115640396-115640418 TAGTGAGAAAGTGATGAAGTAGG - Intergenic
1033239705 7:139667260-139667282 CAGTGACAAAGTTTATAAGATGG - Intronic
1034467328 7:151237793-151237815 CAGTGACATAGGGCATAGGTAGG - Exonic
1038953047 8:32436846-32436868 CAGTGTCACAGTGCATAACTGGG + Intronic
1039012510 8:33110133-33110155 CACTGACAAAGTGTTTCTGTGGG + Intergenic
1040833257 8:51702606-51702628 CATTGACAAGGTACTTAAGCGGG + Intronic
1041958710 8:63586321-63586343 CAGTTAGAAAGTGCTAGAGTTGG - Intergenic
1042111594 8:65387046-65387068 CTGTGATAAAGTACTTATGTTGG - Intergenic
1044838853 8:96320951-96320973 CAGTTACAAAATGTGTAAGTGGG - Intronic
1045105946 8:98892671-98892693 TAGTAAGAAAGTGCTAAAGTAGG - Intronic
1048752042 8:137689188-137689210 CTGTGAAAAAGTTCTTTAGTTGG + Intergenic
1057466103 9:95316480-95316502 CAGCCACAAAGAGCTGAAGTTGG + Intronic
1058839993 9:108896917-108896939 CACAGAGAAAGTGCTTAAGGTGG - Intronic
1186701470 X:12094809-12094831 CAGTAACAAAGTGGTAAACTGGG - Intergenic
1188344455 X:29046453-29046475 CTGTGACAAAGTGCTTAGCCTGG - Intronic
1188461109 X:30428345-30428367 CATTTACAAAATGTTTAAGTAGG - Intergenic
1190137079 X:47807225-47807247 CTGTGACAAAGTGCTGAGCTTGG - Intergenic
1192461795 X:71323362-71323384 CAGTGACCAAGGGGTTAACTGGG + Intergenic
1196846920 X:119903845-119903867 CATGGACAAATTGCTTAAGTAGG - Intronic
1200831503 Y:7691257-7691279 CAGAAACAAGGTGCTTAAGACGG + Intergenic