ID: 901847579

View in Genome Browser
Species Human (GRCh38)
Location 1:11993609-11993631
Sequence TCCCAAGTAGCTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094658
Summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901847579_901847586 -4 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847586 1:11993628-11993650 GGGAGGCTAGGGCAGGAGAATGG 0: 12
1: 1173
2: 63174
3: 46007
4: 20886
901847579_901847591 15 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847591 1:11993647-11993669 ATGGTGTGAACCCCAGGGGGCGG 0: 14
1: 307
2: 305
3: 324
4: 655
901847579_901847588 10 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847588 1:11993642-11993664 GGAGAATGGTGTGAACCCCAGGG 0: 13
1: 341
2: 584
3: 1091
4: 1727
901847579_901847587 9 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847587 1:11993641-11993663 AGGAGAATGGTGTGAACCCCAGG 0: 61
1: 827
2: 1004
3: 1367
4: 3276
901847579_901847590 12 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
901847579_901847589 11 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847589 1:11993643-11993665 GAGAATGGTGTGAACCCCAGGGG 0: 44
1: 679
2: 10061
3: 45622
4: 51127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901847579 Original CRISPR TCCCAAGTAGCTGGGACTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr