ID: 901847584

View in Genome Browser
Species Human (GRCh38)
Location 1:11993618-11993640
Sequence GCCCTAGCCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543443
Summary {0: 73, 1: 3837, 2: 91471, 3: 202528, 4: 245534}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901847584_901847590 3 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
901847584_901847591 6 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847591 1:11993647-11993669 ATGGTGTGAACCCCAGGGGGCGG 0: 14
1: 307
2: 305
3: 324
4: 655
901847584_901847589 2 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847589 1:11993643-11993665 GAGAATGGTGTGAACCCCAGGGG 0: 44
1: 679
2: 10061
3: 45622
4: 51127
901847584_901847596 30 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847596 1:11993671-11993693 GCCTGCAGTGAGCCGAGATCGGG 0: 18
1: 507
2: 1942
3: 3342
4: 3629
901847584_901847595 29 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847595 1:11993670-11993692 AGCCTGCAGTGAGCCGAGATCGG 0: 16
1: 535
2: 1708
3: 2764
4: 2561
901847584_901847587 0 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847587 1:11993641-11993663 AGGAGAATGGTGTGAACCCCAGG 0: 61
1: 827
2: 1004
3: 1367
4: 3276
901847584_901847588 1 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847588 1:11993642-11993664 GGAGAATGGTGTGAACCCCAGGG 0: 13
1: 341
2: 584
3: 1091
4: 1727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901847584 Original CRISPR GCCCTAGCCTCCCAAGTAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr