ID: 901847590

View in Genome Browser
Species Human (GRCh38)
Location 1:11993644-11993666
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901847579_901847590 12 Left 901847579 1:11993609-11993631 CCTGTAGTCCCAGCTACTTGGGA 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725
Right 901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
901847584_901847590 3 Left 901847584 1:11993618-11993640 CCAGCTACTTGGGAGGCTAGGGC 0: 73
1: 3837
2: 91471
3: 202528
4: 245534
Right 901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
901847582_901847590 4 Left 901847582 1:11993617-11993639 CCCAGCTACTTGGGAGGCTAGGG 0: 99
1: 4939
2: 105258
3: 216358
4: 260817
Right 901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901847590 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intronic
Too many off-targets to display for this crispr