ID: 901848402

View in Genome Browser
Species Human (GRCh38)
Location 1:11999327-11999349
Sequence GAAGATGCACTAATGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901848402_901848405 -3 Left 901848402 1:11999327-11999349 CCCTGCTGCATTAGTGCATCTTC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 901848405 1:11999347-11999369 TTCAGTGCCGGTGCTCAGTTTGG 0: 1
1: 0
2: 1
3: 7
4: 67
901848402_901848407 6 Left 901848402 1:11999327-11999349 CCCTGCTGCATTAGTGCATCTTC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 901848407 1:11999356-11999378 GGTGCTCAGTTTGGTTTCTGAGG 0: 1
1: 0
2: 2
3: 17
4: 201
901848402_901848408 23 Left 901848402 1:11999327-11999349 CCCTGCTGCATTAGTGCATCTTC 0: 1
1: 0
2: 0
3: 19
4: 184
Right 901848408 1:11999373-11999395 CTGAGGAATTAATACAGAACAGG 0: 1
1: 0
2: 0
3: 21
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901848402 Original CRISPR GAAGATGCACTAATGCAGCA GGG (reversed) Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903854986 1:26331744-26331766 GAACAGGCACTACAGCAGCAGGG + Intronic
908537132 1:65088968-65088990 GAAGAAGCACTCATCCAGCAGGG + Intergenic
909533668 1:76709034-76709056 GAAGATGCATTCTTGCAACAAGG - Intergenic
910860625 1:91739695-91739717 GAGAATGGACTAATGCAGCAGGG - Intronic
911057093 1:93718344-93718366 GAATGCGTACTAATGCAGCAGGG + Intronic
920724184 1:208418333-208418355 GAACATGCATTAATGCCTCATGG + Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
923415624 1:233757102-233757124 GAATTTCCACTAATGCAGCGAGG + Intergenic
923977892 1:239285347-239285369 GAAAACAGACTAATGCAGCATGG - Intergenic
924855315 1:247869665-247869687 CCAGATGCTCTAATTCAGCATGG - Intronic
1064791569 10:18962412-18962434 GAAAATGGACTAATACAGGAGGG - Intergenic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1067809354 10:49415309-49415331 GTAGATGACCGAATGCAGCATGG + Intergenic
1068264423 10:54627638-54627660 GAAAATGGACTAATACAGCCAGG + Intronic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069666490 10:70164520-70164542 AAAGTTGCACTACTGCAGAATGG + Intronic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073571383 10:104583596-104583618 GAAAATGGACTAATACAGCAGGG + Intergenic
1074699524 10:116080930-116080952 GCAAATACATTAATGCAGCAAGG + Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1081887125 11:46507532-46507554 GAGGATGCGCTAAAGGAGCAGGG - Intronic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1086578591 11:88369906-88369928 GAAGATGTACTGATGCTTCAAGG - Intergenic
1087237444 11:95735936-95735958 AAAGATGCAGTAACGCAGCTGGG - Intergenic
1090538704 11:127676411-127676433 GGAAATGCACTAATACAGTATGG - Intergenic
1092094585 12:5831142-5831164 GAGGATGCACTGATGAAGGAAGG + Intronic
1092587377 12:9912978-9913000 AAAACTGCACTAATGCAACAAGG + Intronic
1092795268 12:12104502-12104524 CAAAATGGACTAATACAGCAGGG + Intronic
1093924810 12:24899184-24899206 GAGGATGCAGTTTTGCAGCAGGG - Intronic
1094502844 12:31036145-31036167 GAAGATGCACTGCTGCTGCTGGG - Intergenic
1097955656 12:65483140-65483162 GAAAATGGACTAATACAGCCTGG + Intronic
1102242626 12:111334589-111334611 GAAGATGTACTCAGGCAGCCAGG + Exonic
1104334590 12:127881487-127881509 GAAGATTCACTGATGCCACAGGG + Intergenic
1104654478 12:130563604-130563626 AAATATGCCCTACTGCAGCAGGG + Intronic
1105845497 13:24290525-24290547 GAAGATGGACTACTGCAAGAAGG - Intronic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1108115197 13:47119866-47119888 AAAGATGCAATAATGCTGCAAGG + Intergenic
1108263879 13:48685020-48685042 GAGAATGGACTAATACAGCAGGG - Intronic
1108512434 13:51168600-51168622 GAGGAAGCAATAATGCAGAATGG + Intergenic
1109588702 13:64446444-64446466 GAAAATGGACTAATACAACAGGG - Intergenic
1111344197 13:86926935-86926957 AAAAATGGACTAATACAGCAGGG - Intergenic
1112120514 13:96405150-96405172 GAAAACGAACTAATACAGCAGGG + Intronic
1112595192 13:100801470-100801492 GAATCTGCATTAATGCAGCCAGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115806990 14:37062877-37062899 GAGAATGCACTAATACACCAGGG - Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1119905691 14:78299658-78299680 GCAGACACACTGATGCAGCATGG + Intronic
1120178621 14:81321051-81321073 GAAAACGCACTAATACTGCAGGG + Intronic
1121857234 14:97281489-97281511 GGAGATGCATTAATGAACCAAGG + Intergenic
1128778269 15:70340575-70340597 GAAGCTTCCCTAATGCAGAAGGG + Intergenic
1129025264 15:72566239-72566261 AAAAATGCACTGATGAAGCATGG + Intronic
1129990164 15:79955108-79955130 GAAAATTGACTAATGCAGCATGG - Intergenic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1140665326 16:77222219-77222241 GAACCTGGACTAATACAGCAAGG - Intergenic
1146486320 17:33245846-33245868 GAGGAAGCACTAATGGAGGAAGG + Intronic
1149251653 17:54777239-54777261 GAAAATGAACTAATGCAGTAAGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1151350667 17:73530158-73530180 GAAAATGGACTAATGCAGGAGGG - Intronic
1152020943 17:77779923-77779945 GAAGATGCACCAGTGCAGGCGGG - Intergenic
1155407184 18:25501875-25501897 GAAGATGCAGTATTTCAGGAAGG + Intergenic
1157093434 18:44663119-44663141 GACTATGCACTAAAGGAGCATGG - Intergenic
1157698904 18:49747012-49747034 GAAAATGGACTAATACAGGAGGG + Intergenic
1158132005 18:54162423-54162445 GAACATGTACTAATTCAACAAGG + Intronic
1158350597 18:56561674-56561696 GAAGATGCTCAAATGCTCCAAGG + Intergenic
1159206117 18:65255214-65255236 GAATCTGCACTAATGCAGCCTGG + Intergenic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1160075562 18:75672209-75672231 AAAGATGGACTAATGCTGTATGG + Intergenic
1164781401 19:30896472-30896494 GGAGAAGCACTAAGGCAGCCTGG - Intergenic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925426858 2:3756590-3756612 GCACTTGCACTAATGCAGCGTGG + Intronic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
927098764 2:19770525-19770547 GAAAATGGACTAATACAACATGG - Intergenic
927385184 2:22524410-22524432 TAATCTGCACTAATGCAGCCAGG + Intergenic
927398079 2:22678503-22678525 GAATATGCACTGATACAGCCAGG + Intergenic
927423716 2:22958171-22958193 GAAGATGCTCTACAGCACCAGGG - Intergenic
928133790 2:28672852-28672874 GAGAATGGACTAATACAGCATGG + Intergenic
928848955 2:35718313-35718335 GAGAATGAACTAATACAGCATGG + Intergenic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
929417517 2:41758775-41758797 GAAAATTGACTAATGCAGTATGG - Intergenic
931218731 2:60270032-60270054 TGAGATGCACCAATGCAACAGGG + Intergenic
932126466 2:69149478-69149500 GTAGATGAACTAAAGCAGAAGGG - Intronic
937295363 2:120806855-120806877 GAAGATGCATTTAAGAAGCAGGG + Intronic
937345012 2:121120027-121120049 GAAAATGGACTAATACAGTAGGG - Intergenic
938852343 2:135274266-135274288 GAAGATGCAGTAAAGCCACATGG + Intronic
945347931 2:208740616-208740638 GAAAATGAACTAATTTAGCAAGG + Intronic
945570397 2:211459783-211459805 GAAAATGGACTAATACAGGAGGG + Intronic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
948551264 2:238774446-238774468 GAAAATGGACTAATACAGCAGGG - Intergenic
1168827963 20:826678-826700 GAAAACGAACTAATACAGCACGG + Intergenic
1171041226 20:21765575-21765597 GCAGATGCACTTAAGAAGCAGGG - Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1172671007 20:36634442-36634464 GAATATGCACTAATAGAGCCAGG - Intronic
1173172196 20:40736453-40736475 GAGAATGGACTAATACAGCAAGG - Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1179078835 21:38151035-38151057 GAAGATGCACTAATGAGAAATGG - Intronic
1181185944 22:21103792-21103814 GAAGATTTAAAAATGCAGCAAGG - Intergenic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182713943 22:32340343-32340365 GAAGATTCATTCATGCAACATGG + Intergenic
1184401255 22:44275927-44275949 GAAGATTCATTCATGCAACATGG + Intronic
949683585 3:6542686-6542708 TCAGATCCACTAATGCAGAATGG - Intergenic
951840187 3:27025907-27025929 GAAGAGGCACTAGCTCAGCAGGG + Intergenic
952931399 3:38363869-38363891 GAAAATACAGTAATCCAGCATGG - Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
954014173 3:47671671-47671693 GAAGATGAGTGAATGCAGCAGGG - Intronic
957561441 3:81826810-81826832 GAAAACGGACTAATGCAACATGG + Intergenic
961603930 3:128079691-128079713 GAAGATTCACTCTGGCAGCAGGG + Intronic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962481249 3:135800528-135800550 GAGCAAGCACTAAAGCAGCAAGG - Intergenic
963471466 3:145747419-145747441 GAAAATGAACTAATACAGCATGG - Intergenic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
965074110 3:163954122-163954144 GAAAATGTACTTATGCACCATGG + Intergenic
965152906 3:165005208-165005230 GAAAATAGACTAATACAGCAGGG + Intronic
965455319 3:168892516-168892538 GAATTTGCACTAAAACAGCAAGG - Intergenic
965963105 3:174452425-174452447 GAAGCAGCAGCAATGCAGCAGGG - Intronic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
969065638 4:4478350-4478372 GAAGGTTCACAAATACAGCAAGG + Intronic
969090075 4:4687230-4687252 GGAGATGGCCTAATACAGCAAGG - Intergenic
971021839 4:22545206-22545228 GAAAATGTACTAATACAGGAGGG - Intergenic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
975237191 4:72013304-72013326 GAGAATGGACTAATACAGCATGG - Intergenic
975876026 4:78837969-78837991 GAAAATGGACTAATACAGCAAGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976892671 4:90069033-90069055 GAAAATGAACTAATACAGTATGG + Intergenic
979340960 4:119523494-119523516 GAAGAGGCACTAAGGAAGGAAGG + Intronic
979568005 4:122178753-122178775 AATTATGCACTAATGCAGAAGGG - Intronic
979833453 4:125330312-125330334 GAAGATGAAGAAATGCCGCAAGG - Intronic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
986716320 5:10526573-10526595 TAAAATGCACTAAGGCAGCGGGG + Intergenic
987795904 5:22626250-22626272 GAAGCTGCAGTGATGCATCAGGG - Intronic
988701460 5:33679275-33679297 GAAAATGGACTAATACAGGAAGG - Intronic
988942469 5:36160013-36160035 AAAGATTAAATAATGCAGCAGGG - Intronic
990848882 5:60178257-60178279 GAAAATGTCCTAATGCAGGAAGG - Intronic
990973424 5:61535157-61535179 GATGTTGCTCAAATGCAGCAAGG + Intronic
991256808 5:64622854-64622876 GAAGGTGCACTAGCGCAGGAGGG + Intergenic
992553330 5:77880153-77880175 GAGGATTCACTGATGCAGCCAGG + Intergenic
992986694 5:82237800-82237822 GTAGATGCCCTAATGGAGTATGG + Intronic
993982532 5:94559943-94559965 GAATCTGCATTAATGCAGCCAGG + Intronic
996333134 5:122353826-122353848 GAAAATGGACTAATACGGCAGGG + Intronic
997065471 5:130554382-130554404 GAGAATGGACTAATGCACCAAGG - Intergenic
998204266 5:140147866-140147888 GAAGACACAATACTGCAGCAAGG - Intergenic
998687716 5:144548750-144548772 GAGAATGGACTAATACAGCATGG + Intergenic
1003001408 6:2338099-2338121 GAAGAAGAAATAATGAAGCAAGG + Intergenic
1006191099 6:32210084-32210106 GAAGAGGCCCTAATCCAGCCTGG + Intronic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006470455 6:34225869-34225891 GAAAATGCCCTTATTCAGCAAGG - Intergenic
1007891087 6:45292522-45292544 GAAGATACAGAAATGCAGAATGG + Intronic
1011207875 6:84920511-84920533 GAAAAAGCACTAAAGCACCAGGG + Intergenic
1012576217 6:100803163-100803185 GAAATTGCACTAAGCCAGCAAGG - Intronic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1015248384 6:131100863-131100885 GAAGATTCCCTAAGGAAGCAGGG + Intergenic
1016217822 6:141624601-141624623 GAACTTGCAGTGATGCAGCAAGG - Intergenic
1016237551 6:141886871-141886893 GAGAATGGACTAATACAGCATGG - Intergenic
1018585706 6:165355870-165355892 GAAAATGGACTAATACAGCAAGG - Intronic
1019150703 6:170003739-170003761 GAGAATGGACTAATACAGCAAGG - Intergenic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1026815423 7:73507505-73507527 GAAACTGCACTATTCCAGCATGG + Intronic
1029814309 7:103077321-103077343 GAAAATGGACTAATACAGTAAGG - Intronic
1031600893 7:123707887-123707909 TAAGATGCACTAATTTAGCCCGG + Intronic
1032855512 7:135830362-135830384 GAGGATGCACTAAAGCCTCAGGG + Intergenic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1035067505 7:156118553-156118575 GAAGAGGAACTCATTCAGCACGG - Intergenic
1040068687 8:43171034-43171056 GAAGATGCACTAGTCTAGCAAGG + Intronic
1040577578 8:48667255-48667277 GAAAATGAACTAATACAGCCAGG - Intergenic
1042432254 8:68721378-68721400 GAAGAAGCACTAATGGAGGAGGG + Exonic
1042501832 8:69516988-69517010 GAAAATGGACTAAGACAGCAGGG - Intronic
1043050596 8:75380633-75380655 GAAAATGGACTAATGCCGCATGG + Intergenic
1044386363 8:91593593-91593615 GATAATGCAATCATGCAGCATGG - Intergenic
1044541501 8:93413508-93413530 GAAAACGGACTAATACAGCAGGG - Intergenic
1046662518 8:116963571-116963593 AAGGATGCACTAATGCAATATGG - Intronic
1048171540 8:132111368-132111390 GACAATGCACTGATTCAGCATGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055029440 9:71758683-71758705 AAATATGCATTAATGCAGCCAGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060205316 9:121679393-121679415 GTACATGCACAAATGCAGAAGGG - Intronic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1062373894 9:136253516-136253538 GTAGATGCAGTTCTGCAGCAGGG - Intergenic
1185731853 X:2467997-2468019 AAAGGTGCACAAATGCAGCCAGG + Intronic
1189950103 X:46220496-46220518 CAACATGGAGTAATGCAGCATGG + Intergenic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192359859 X:70432628-70432650 GAAGGTCCACAAAAGCAGCATGG - Exonic
1193889521 X:87027510-87027532 GAAAATGGACTAATACAGTATGG + Intergenic
1194126833 X:90029053-90029075 TAAAATGGACTAATACAGCAAGG - Intergenic
1199091359 X:143696864-143696886 GAAAATGCTGTAATGCAGCATGG - Intergenic
1199219549 X:145301573-145301595 GAAAATGGACTAATGCAGTCAGG + Intergenic
1201012441 Y:9560901-9560923 GAAAATGAACTAATACAGGAGGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201704478 Y:16921111-16921133 GAAAATGGACTAATGCAGGAAGG - Intergenic