ID: 901849131

View in Genome Browser
Species Human (GRCh38)
Location 1:12004312-12004334
Sequence AACGCCCACATGATCTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901849131_901849135 14 Left 901849131 1:12004312-12004334 CCTCCACAGATCATGTGGGCGTT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 901849135 1:12004349-12004371 CCCAGACCCTCTCACTTCAGAGG 0: 1
1: 0
2: 3
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901849131 Original CRISPR AACGCCCACATGATCTGTGG AGG (reversed) Intronic
901849131 1:12004312-12004334 AACGCCCACATGATCTGTGGAGG - Intronic
906258433 1:44368073-44368095 AACCCTGACATGGTCTGTGGTGG + Intergenic
917211681 1:172638179-172638201 AAGGCCCTCATGACCTGCGGGGG + Intergenic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
920050813 1:203163737-203163759 AAAGCCCACCTGCTCTGTGAAGG - Intronic
920060420 1:203223418-203223440 AGCCCCCACATGTGCTGTGGGGG + Intronic
921913045 1:220573295-220573317 AAAGCCTCTATGATCTGTGGTGG - Intronic
923258581 1:232244322-232244344 AAGGCACACATGGACTGTGGAGG + Intergenic
1065502062 10:26392185-26392207 AAGGCCCACATGAGCTGACGCGG - Intergenic
1071884025 10:89930252-89930274 AACACCCAGCTGAGCTGTGGGGG + Intergenic
1072233929 10:93437461-93437483 ACAGCCCACATGATTTCTGGAGG + Intronic
1072722794 10:97791276-97791298 TATGCCCAGATGCTCTGTGGTGG + Intergenic
1073664094 10:105510299-105510321 AATGCCCACATGAGCACTGGGGG - Intergenic
1077035202 11:491112-491134 AGCGCCCACACGAGCTGCGGGGG - Exonic
1086887385 11:92221886-92221908 AAGGCCCAGATGATCTGAAGTGG + Intergenic
1092109790 12:5951334-5951356 ACAGCCCACATGTGCTGTGGGGG - Intronic
1093067158 12:14670082-14670104 AAGGCCCACAGAATCTGTGCTGG - Intronic
1098915926 12:76256835-76256857 TATGCCTACATGATGTGTGGTGG + Intergenic
1099293154 12:80797524-80797546 AAAGCCCACGTGAGCAGTGGCGG + Exonic
1103686497 12:122736159-122736181 AACTCCCACATGATGTGGGAGGG + Intergenic
1103826665 12:123744588-123744610 AACATCCTCATGATCTGTGAAGG - Exonic
1105777440 13:23676853-23676875 AAAGTCCACATGCTCTGGGGGGG - Intergenic
1106802353 13:33269407-33269429 ACCGCCCACATTATCTGATGAGG - Intronic
1107834848 13:44404925-44404947 AAAGCCCAAATGATTTGTGTTGG + Intergenic
1109601527 13:64636548-64636570 AATGCCCACATTATCAGTGGTGG + Intergenic
1112187538 13:97142518-97142540 AACACCCACACTATGTGTGGAGG - Intergenic
1114871773 14:26667006-26667028 AATTCCCACATGTTGTGTGGGGG - Intergenic
1118377246 14:65187998-65188020 CACTCCCACAAGAACTGTGGTGG - Intergenic
1118414047 14:65513692-65513714 AACGACCATGAGATCTGTGGAGG + Intronic
1123196631 14:106623294-106623316 AGCGCCCAGATGATCTCAGGGGG - Intergenic
1127143846 15:56004690-56004712 AACAGCCACATAATCTGTGTTGG + Intergenic
1131730695 15:95277294-95277316 AATGTCCACAGCATCTGTGGGGG - Intergenic
1133153397 16:3854074-3854096 AACACCCACATGATCTGAAGTGG + Intronic
1138543058 16:57700005-57700027 CAGGCCCACATGACCTGGGGTGG - Intronic
1145256757 17:21329264-21329286 AATGCCTTCATTATCTGTGGGGG + Intergenic
1145319856 17:21758686-21758708 AATGCCTTCATTATCTGTGGGGG - Intergenic
1147869989 17:43580480-43580502 TACTGCCACATGCTCTGTGGAGG + Intergenic
1151056387 17:71036701-71036723 AACCATCACATAATCTGTGGTGG + Intergenic
1154910423 18:20641621-20641643 AAGGCCCACTTGATCCATGGTGG - Intergenic
1167214560 19:48155784-48155806 ATCGGCAACATGATCTGTGTAGG + Intronic
927022132 2:19028571-19028593 AACGTCCACGTGTTCTGTTGTGG + Intergenic
927323444 2:21775127-21775149 AATGCCCTGATGATCTGAGGCGG - Intergenic
927903197 2:26837919-26837941 ATAGCCCACATGCTCTGTGCAGG - Intergenic
928454473 2:31406613-31406635 AATGCCTGCATGTTCTGTGGTGG - Intronic
931263137 2:60637654-60637676 AACGTCAACATGATTTTTGGTGG + Intergenic
939610292 2:144301712-144301734 AATGCCCACATGCTTTCTGGAGG + Intronic
943417915 2:187631246-187631268 AACTCCCACATGTTGTGTGTGGG + Intergenic
1171195345 20:23193063-23193085 AACATCAACATGCTCTGTGGTGG + Intergenic
1175120080 20:56710552-56710574 CACGCACACATGATCCATGGGGG + Intergenic
1175779927 20:61675907-61675929 AAGGCCCACCTGCACTGTGGAGG + Intronic
1183012114 22:34955360-34955382 AGCGCCCAGCTGTTCTGTGGAGG + Intergenic
953118990 3:40021002-40021024 AATCCCTACAAGATCTGTGGAGG - Intronic
959432118 3:106267876-106267898 AAAGCCTACATGAACTGAGGAGG + Intergenic
971984085 4:33796752-33796774 AAAGGCTACATGATATGTGGAGG - Intergenic
977692740 4:99933824-99933846 AACTGCCACAAGATCTGTGTGGG + Intronic
986653465 5:9988049-9988071 AGCTTCCACATGCTCTGTGGTGG - Intergenic
987747735 5:21998395-21998417 AAACTACACATGATCTGTGGTGG - Intronic
988221395 5:28350377-28350399 AATCCCCACATGATGTGAGGAGG - Intergenic
991767916 5:70008188-70008210 AAACCACACATGATCTGTGGTGG - Intergenic
991847150 5:70883266-70883288 AAACCACACATGATCTGTGGTGG - Intergenic
992171959 5:74111501-74111523 AACGCTCACATTATCACTGGTGG + Intergenic
1011881351 6:92031952-92031974 TCAGCCTACATGATCTGTGGGGG - Intergenic
1017359528 6:153550780-153550802 ATATCCTACATGATCTGTGGTGG - Intergenic
1017533004 6:155315111-155315133 AGCTCCCACGTGATCAGTGGTGG + Intergenic
1017546723 6:155459806-155459828 AAAGCCCACATCATCTTTTGTGG - Intergenic
1018591854 6:165434465-165434487 AATGTCCACATGTACTGTGGAGG + Intronic
1019970060 7:4533605-4533627 AACGCCCACATGTTGTGGGAGGG + Intergenic
1024369769 7:48567968-48567990 AACACACACATGCTCTATGGAGG - Intronic
1029360042 7:100081790-100081812 AACGCCCACTTGTTCTGTCTAGG + Intronic
1038324419 8:26561706-26561728 AAGGCCCTGATGATCTGAGGTGG - Intronic
1044964396 8:97561095-97561117 TCCGCCCACATGATTTTTGGGGG - Intergenic
1049538990 8:143197927-143197949 AACTCCAACATGAGCTTTGGAGG + Intergenic
1053344220 9:37366052-37366074 AATGGCCCCATGTTCTGTGGAGG - Intergenic
1057169197 9:92950701-92950723 AGGGCCCTCATGAACTGTGGAGG + Intronic
1057275967 9:93676090-93676112 AACACCCACATGATGGGGGGAGG - Intronic
1058032309 9:100213709-100213731 AACTTCCACATGTTCTCTGGGGG - Intronic
1061670436 9:132185328-132185350 AAGGCCCCCAGGATCTGGGGAGG + Intronic
1187245802 X:17551891-17551913 AAAACCCATATGATCTGTGCTGG - Intronic
1191257025 X:58283972-58283994 AACCCGCACCTGATCTGGGGTGG - Intergenic
1192742496 X:73906534-73906556 AACTCCCAAATGATCTATTGTGG - Intergenic
1196389955 X:115196501-115196523 TATGCCAACATGAACTGTGGGGG + Intronic