ID: 901854561

View in Genome Browser
Species Human (GRCh38)
Location 1:12036355-12036377
Sequence GGAGTGCAGTGGCGCGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483324
Summary {0: 21768, 1: 89330, 2: 155366, 3: 136299, 4: 80561}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901854561_901854568 25 Left 901854561 1:12036355-12036377 CCAAGATCGCGCCACTGCACTCC 0: 21768
1: 89330
2: 155366
3: 136299
4: 80561
Right 901854568 1:12036403-12036425 GTCTCAGAAAAAGAAAAAAGAGG No data
901854561_901854570 30 Left 901854561 1:12036355-12036377 CCAAGATCGCGCCACTGCACTCC 0: 21768
1: 89330
2: 155366
3: 136299
4: 80561
Right 901854570 1:12036408-12036430 AGAAAAAGAAAAAAGAGGCTGGG No data
901854561_901854569 29 Left 901854561 1:12036355-12036377 CCAAGATCGCGCCACTGCACTCC 0: 21768
1: 89330
2: 155366
3: 136299
4: 80561
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901854561 Original CRISPR GGAGTGCAGTGGCGCGATCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr