ID: 901854561 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:12036355-12036377 |
| Sequence | GGAGTGCAGTGGCGCGATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 483324 | |||
| Summary | {0: 21768, 1: 89330, 2: 155366, 3: 136299, 4: 80561} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901854561_901854568 | 25 | Left | 901854561 | 1:12036355-12036377 | CCAAGATCGCGCCACTGCACTCC | 0: 21768 1: 89330 2: 155366 3: 136299 4: 80561 |
||
| Right | 901854568 | 1:12036403-12036425 | GTCTCAGAAAAAGAAAAAAGAGG | No data | ||||
| 901854561_901854570 | 30 | Left | 901854561 | 1:12036355-12036377 | CCAAGATCGCGCCACTGCACTCC | 0: 21768 1: 89330 2: 155366 3: 136299 4: 80561 |
||
| Right | 901854570 | 1:12036408-12036430 | AGAAAAAGAAAAAAGAGGCTGGG | No data | ||||
| 901854561_901854569 | 29 | Left | 901854561 | 1:12036355-12036377 | CCAAGATCGCGCCACTGCACTCC | 0: 21768 1: 89330 2: 155366 3: 136299 4: 80561 |
||
| Right | 901854569 | 1:12036407-12036429 | CAGAAAAAGAAAAAAGAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901854561 | Original CRISPR | GGAGTGCAGTGGCGCGATCT TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||