ID: 901854566

View in Genome Browser
Species Human (GRCh38)
Location 1:12036380-12036402
Sequence GGAGTCTCGCTCTGTCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482171
Summary {0: 20329, 1: 57869, 2: 114465, 3: 140937, 4: 148571}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901854566_901854572 13 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854572 1:12036416-12036438 AAAAAAGAGGCTGGGCATGGTGG 0: 34
1: 386
2: 2859
3: 25462
4: 100865
901854566_901854570 5 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854570 1:12036408-12036430 AGAAAAAGAAAAAAGAGGCTGGG No data
901854566_901854569 4 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data
901854566_901854568 0 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854568 1:12036403-12036425 GTCTCAGAAAAAGAAAAAAGAGG No data
901854566_901854571 10 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854571 1:12036413-12036435 AAGAAAAAAGAGGCTGGGCATGG 0: 7
1: 80
2: 728
3: 3597
4: 15534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901854566 Original CRISPR GGAGTCTCGCTCTGTCGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr