ID: 901854569

View in Genome Browser
Species Human (GRCh38)
Location 1:12036407-12036429
Sequence CAGAAAAAGAAAAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901854564_901854569 18 Left 901854564 1:12036366-12036388 CCACTGCACTCCAGCCTGGGCGA 0: 62339
1: 213994
2: 245652
3: 160170
4: 93749
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data
901854566_901854569 4 Left 901854566 1:12036380-12036402 CCTGGGCGACAGAGCGAGACTCC 0: 20329
1: 57869
2: 114465
3: 140937
4: 148571
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data
901854565_901854569 8 Left 901854565 1:12036376-12036398 CCAGCCTGGGCGACAGAGCGAGA 0: 26768
1: 89687
2: 191248
3: 194442
4: 151704
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data
901854561_901854569 29 Left 901854561 1:12036355-12036377 CCAAGATCGCGCCACTGCACTCC 0: 21768
1: 89330
2: 155366
3: 136299
4: 80561
Right 901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901854569 Original CRISPR CAGAAAAAGAAAAAAGAGGC TGG Intergenic
No off target data available for this crispr