ID: 901855038

View in Genome Browser
Species Human (GRCh38)
Location 1:12039139-12039161
Sequence CTGAGGACAGGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901855026_901855038 18 Left 901855026 1:12039098-12039120 CCGGCAGCAGCCTTCTTGCCAGT No data
Right 901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG No data
901855030_901855038 0 Left 901855030 1:12039116-12039138 CCAGTTTCATTAGCATGGAGGCT No data
Right 901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG No data
901855027_901855038 8 Left 901855027 1:12039108-12039130 CCTTCTTGCCAGTTTCATTAGCA No data
Right 901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901855038 Original CRISPR CTGAGGACAGGGAGGGAGGA GGG Intergenic
No off target data available for this crispr