ID: 901855321

View in Genome Browser
Species Human (GRCh38)
Location 1:12040902-12040924
Sequence AGCTGTGTGTTGCAGAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901855314_901855321 5 Left 901855314 1:12040874-12040896 CCCAGGAGAGGAAGCAGCCCCAG No data
Right 901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG No data
901855315_901855321 4 Left 901855315 1:12040875-12040897 CCAGGAGAGGAAGCAGCCCCAGG No data
Right 901855321 1:12040902-12040924 AGCTGTGTGTTGCAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901855321 Original CRISPR AGCTGTGTGTTGCAGAACAC TGG Intergenic
No off target data available for this crispr