ID: 901857467

View in Genome Browser
Species Human (GRCh38)
Location 1:12053545-12053567
Sequence CCCACTCTCATGCTTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857467_901857476 10 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857476 1:12053578-12053600 GTGGCCGGGCTCAGGCCCCAAGG No data
901857467_901857471 -5 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857471 1:12053563-12053585 GTGGGACGCCAGCCAGTGGCCGG No data
901857467_901857472 -4 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857472 1:12053564-12053586 TGGGACGCCAGCCAGTGGCCGGG No data
901857467_901857470 -9 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857470 1:12053559-12053581 GAGAGTGGGACGCCAGCCAGTGG No data
901857467_901857480 24 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857480 1:12053592-12053614 GCCCCAAGGAAACACAAGGTGGG No data
901857467_901857473 2 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857473 1:12053570-12053592 GCCAGCCAGTGGCCGGGCTCAGG No data
901857467_901857479 23 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857467_901857478 20 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857478 1:12053588-12053610 TCAGGCCCCAAGGAAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857467 Original CRISPR CCCACTCTCATGCTTGGCAG TGG (reversed) Intergenic
No off target data available for this crispr