ID: 901857469

View in Genome Browser
Species Human (GRCh38)
Location 1:12053551-12053573
Sequence TGGCGTCCCACTCTCATGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857469_901857473 -4 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857473 1:12053570-12053592 GCCAGCCAGTGGCCGGGCTCAGG No data
901857469_901857472 -10 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857472 1:12053564-12053586 TGGGACGCCAGCCAGTGGCCGGG No data
901857469_901857478 14 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857478 1:12053588-12053610 TCAGGCCCCAAGGAAACACAAGG No data
901857469_901857479 17 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857469_901857484 30 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data
901857469_901857476 4 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857476 1:12053578-12053600 GTGGCCGGGCTCAGGCCCCAAGG No data
901857469_901857480 18 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857480 1:12053592-12053614 GCCCCAAGGAAACACAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857469 Original CRISPR TGGCGTCCCACTCTCATGCT TGG (reversed) Intergenic
No off target data available for this crispr