ID: 901857475

View in Genome Browser
Species Human (GRCh38)
Location 1:12053575-12053597
Sequence TGGGGCCTGAGCCCGGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857475_901857485 7 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857485 1:12053605-12053627 ACAAGGTGGGCTGCTGCTTTGGG No data
901857475_901857484 6 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data
901857475_901857486 8 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG No data
901857475_901857478 -10 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857478 1:12053588-12053610 TCAGGCCCCAAGGAAACACAAGG No data
901857475_901857480 -6 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857480 1:12053592-12053614 GCCCCAAGGAAACACAAGGTGGG No data
901857475_901857479 -7 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857475_901857487 19 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857475 Original CRISPR TGGGGCCTGAGCCCGGCCAC TGG (reversed) Intergenic
No off target data available for this crispr