ID: 901857479

View in Genome Browser
Species Human (GRCh38)
Location 1:12053591-12053613
Sequence GGCCCCAAGGAAACACAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857475_901857479 -7 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857467_901857479 23 Left 901857467 1:12053545-12053567 CCACTGCCAAGCATGAGAGTGGG No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857474_901857479 -3 Left 901857474 1:12053571-12053593 CCAGCCAGTGGCCGGGCTCAGGC No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data
901857469_901857479 17 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857479 Original CRISPR GGCCCCAAGGAAACACAAGG TGG Intergenic
No off target data available for this crispr