ID: 901857484

View in Genome Browser
Species Human (GRCh38)
Location 1:12053604-12053626
Sequence CACAAGGTGGGCTGCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857477_901857484 -1 Left 901857477 1:12053582-12053604 CCGGGCTCAGGCCCCAAGGAAAC No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data
901857474_901857484 10 Left 901857474 1:12053571-12053593 CCAGCCAGTGGCCGGGCTCAGGC No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data
901857475_901857484 6 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data
901857469_901857484 30 Left 901857469 1:12053551-12053573 CCAAGCATGAGAGTGGGACGCCA No data
Right 901857484 1:12053604-12053626 CACAAGGTGGGCTGCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857484 Original CRISPR CACAAGGTGGGCTGCTGCTT TGG Intergenic
No off target data available for this crispr