ID: 901857486

View in Genome Browser
Species Human (GRCh38)
Location 1:12053606-12053628
Sequence CAAGGTGGGCTGCTGCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857475_901857486 8 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG No data
901857474_901857486 12 Left 901857474 1:12053571-12053593 CCAGCCAGTGGCCGGGCTCAGGC No data
Right 901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG No data
901857477_901857486 1 Left 901857477 1:12053582-12053604 CCGGGCTCAGGCCCCAAGGAAAC No data
Right 901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG No data
901857481_901857486 -10 Left 901857481 1:12053593-12053615 CCCCAAGGAAACACAAGGTGGGC No data
Right 901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857486 Original CRISPR CAAGGTGGGCTGCTGCTTTG GGG Intergenic
No off target data available for this crispr