ID: 901857487

View in Genome Browser
Species Human (GRCh38)
Location 1:12053617-12053639
Sequence GCTGCTTTGGGGACGTTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901857474_901857487 23 Left 901857474 1:12053571-12053593 CCAGCCAGTGGCCGGGCTCAGGC No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data
901857483_901857487 -1 Left 901857483 1:12053595-12053617 CCAAGGAAACACAAGGTGGGCTG No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data
901857482_901857487 0 Left 901857482 1:12053594-12053616 CCCAAGGAAACACAAGGTGGGCT No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data
901857475_901857487 19 Left 901857475 1:12053575-12053597 CCAGTGGCCGGGCTCAGGCCCCA No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data
901857477_901857487 12 Left 901857477 1:12053582-12053604 CCGGGCTCAGGCCCCAAGGAAAC No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data
901857481_901857487 1 Left 901857481 1:12053593-12053615 CCCCAAGGAAACACAAGGTGGGC No data
Right 901857487 1:12053617-12053639 GCTGCTTTGGGGACGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901857487 Original CRISPR GCTGCTTTGGGGACGTTGTT TGG Intergenic
No off target data available for this crispr