ID: 901859282

View in Genome Browser
Species Human (GRCh38)
Location 1:12063835-12063857
Sequence CTGGCTGAAGGGCTAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901859276_901859282 -8 Left 901859276 1:12063820-12063842 CCCACAGGTGGGAGGCTGGCTGA 0: 1
1: 0
2: 1
3: 27
4: 217
Right 901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG 0: 1
1: 0
2: 3
3: 8
4: 167
901859277_901859282 -9 Left 901859277 1:12063821-12063843 CCACAGGTGGGAGGCTGGCTGAA 0: 1
1: 0
2: 2
3: 31
4: 330
Right 901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG 0: 1
1: 0
2: 3
3: 8
4: 167
901859270_901859282 8 Left 901859270 1:12063804-12063826 CCGGAATATGCTAGCACCCACAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG 0: 1
1: 0
2: 3
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901859282 Original CRISPR CTGGCTGAAGGGCTAGTGGT GGG Intronic
900194910 1:1371258-1371280 CTGGGTGAGGGGCCAGAGGTGGG - Intergenic
900931879 1:5743013-5743035 CTGGCTGATGGGGCCGTGGTGGG - Intergenic
901002513 1:6155607-6155629 CTGGCTGAAGGCCTTGTAGTTGG + Exonic
901480283 1:9520445-9520467 CTGGCTGAGGGGATAGAGGTGGG - Intergenic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
902744590 1:18464998-18465020 CTGGGTGAAGGGTTACTGGGTGG + Intergenic
902746223 1:18476373-18476395 CTGGGTGCAGGGCAAGGGGTGGG - Intergenic
902919007 1:19655559-19655581 CAGGGTGAAGGGCTTGTGCTGGG + Intronic
903112830 1:21151591-21151613 CATGCTGAAGGCCTAGTGATAGG - Intronic
903580646 1:24368113-24368135 CAGGCTGTAGGGCTAGGGGCTGG - Intronic
903654526 1:24941240-24941262 ATACCTGAAGGGCTACTGGTCGG - Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
905363729 1:37437457-37437479 CTGGCTGAGAAGCCAGTGGTGGG - Intergenic
906476226 1:46171385-46171407 CTGGCTGAATGGGTAGGTGTGGG + Intronic
907588305 1:55641416-55641438 CTGGCTGGAGAGCTGGTGCTAGG - Intergenic
910159891 1:84261357-84261379 CTGGCCTAAGGGCTGCTGGTTGG - Intergenic
911217941 1:95216300-95216322 CTGGGGGAAGGGGCAGTGGTGGG - Intronic
912654805 1:111476827-111476849 CAGGGTGCAGGGCTAGTTGTTGG - Exonic
912954051 1:114140214-114140236 CTGGCTGGGGGGATAGGGGTGGG - Intronic
915510031 1:156381827-156381849 CTGGCTGGAGGGGTTGTGGTGGG + Exonic
915925089 1:160011178-160011200 CTGGCTGAAGGGCTCCTCCTGGG - Intergenic
923034665 1:230277265-230277287 CTGTCTGATGGGATTGTGGTTGG - Intronic
1063543980 10:6962203-6962225 CTGGCTGGAGGGGAAGTTGTCGG - Intergenic
1063573330 10:7237570-7237592 AGGGGTGAAGGGCTAGGGGTGGG + Intronic
1063655419 10:7983266-7983288 CTGTCAGAAGGGGAAGTGGTAGG + Intronic
1066046948 10:31603102-31603124 CTGGCTTGAGGGGTCGTGGTGGG - Intergenic
1067698435 10:48551963-48551985 CTGGCTGAAAGGCTGGGGGTGGG + Intronic
1068568270 10:58599500-58599522 GTGGGTGAAGGGCTAGAGGAGGG + Intronic
1070828673 10:79405661-79405683 CTGGCTGGAGGGAAGGTGGTGGG + Intronic
1071782030 10:88856645-88856667 TTGGATGAAGAGCTATTGGTGGG - Intergenic
1071914020 10:90270070-90270092 CAGGCAGAAAGGCTAGTGATAGG - Intergenic
1074611391 10:115025442-115025464 CTGGCTGCAGGGGTGGGGGTTGG - Intergenic
1077015076 11:395762-395784 CTGGCTGAGGGGCTCAGGGTGGG - Intronic
1077155293 11:1088397-1088419 CAGGCTGCAGGGCTCGGGGTTGG - Intergenic
1077310236 11:1885352-1885374 GTGGATGAAGGACTATTGGTTGG - Intronic
1077496754 11:2890406-2890428 CTGGCTCTAGGGCTTGGGGTGGG - Intronic
1078016198 11:7617245-7617267 CTGGCTGCAGGGCTGGGGCTCGG - Intronic
1078603232 11:12751600-12751622 ATGGCTGAAGGGACAGGGGTGGG + Intronic
1080442238 11:32305386-32305408 CAGGCTGCAGTGCTAGAGGTGGG - Intergenic
1083296488 11:61718178-61718200 CTGGCTGGAGGGCTAGGGTCTGG - Intronic
1085276811 11:75305882-75305904 CTGACTGAAGGGCTACTGTGGGG - Intronic
1089119117 11:116119358-116119380 CTGCCGGAAGGTCTTGTGGTTGG + Intergenic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1089779026 11:120860128-120860150 GTGGCTGACGGGCTAGTCCTAGG + Intronic
1090668318 11:128929792-128929814 CTGGCTCAGGGGCTTCTGGTAGG + Intergenic
1090839249 11:130474483-130474505 CAGGGTGTAGGACTAGTGGTAGG + Exonic
1091485351 12:881420-881442 CTGGCTGCATGGCAAGTTGTAGG + Intronic
1092203490 12:6601656-6601678 CTGGCTGAAGGCCTTGTAGTTGG + Exonic
1093316718 12:17660839-17660861 CTGGCTGAATATCTTGTGGTTGG - Intergenic
1097075218 12:56388081-56388103 CTGGAAGGATGGCTAGTGGTTGG + Intergenic
1097157983 12:57026624-57026646 CTGGCTGAAGGGAGAGGGCTGGG + Intronic
1098680187 12:73344504-73344526 CAGGGTGAAGGGCTAGGGGAGGG - Intergenic
1101020278 12:100546749-100546771 ATGGCTGGAGGGTTAGTGGATGG - Intronic
1107055336 13:36097203-36097225 GTGGCTGCTGGGCTAGGGGTGGG + Intronic
1108453582 13:50590761-50590783 CTGGCTGGAGAGGAAGTGGTGGG - Intronic
1108856614 13:54800352-54800374 AAGGCTGAAGAGCTAGTGGGAGG + Intergenic
1109469029 13:62779972-62779994 CTGGCTGAAGGGGGAAGGGTTGG + Intergenic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1115642492 14:35343585-35343607 CTGGCTGATGGGATAGGGCTGGG - Intergenic
1119141829 14:72274332-72274354 CTGGATGCAGCACTAGTGGTTGG - Intronic
1119856696 14:77906369-77906391 CTGGCTGTGGGGGTACTGGTGGG + Intronic
1120897974 14:89551385-89551407 CGGGTTGAAGGGATAGTGGATGG - Intronic
1124689399 15:31809359-31809381 CTGGCTTGAGCGGTAGTGGTGGG + Intronic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1126315492 15:47365065-47365087 CCAGCTGAAGGGCTAATGATTGG - Intronic
1126846476 15:52765164-52765186 ATGGCTGAAGGGGTAGTGGTGGG + Intronic
1128075190 15:64821428-64821450 CTGGCTGAACTGCCAGCGGTTGG - Exonic
1131149881 15:90040711-90040733 CTGGCTGGAGGGCTGGAGTTGGG - Intronic
1131176648 15:90213464-90213486 ATGGCTGGAGGGCTTGTGGCTGG + Intronic
1132117874 15:99150852-99150874 CTGGCTGTAGGGTTGCTGGTGGG - Intronic
1134100752 16:11449828-11449850 TTTGCTGATGGACTAGTGGTGGG - Intronic
1134685071 16:16152833-16152855 GTGTCCGAAGGGCTTGTGGTAGG - Intronic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1137825723 16:51493208-51493230 CTGGGTGAAGGGTTTGGGGTTGG - Intergenic
1141660058 16:85436802-85436824 CAGGCTGCCGGGCTGGTGGTGGG + Intergenic
1141817868 16:86425274-86425296 GTGAATGAAGGGCTAGGGGTGGG - Intergenic
1142755327 17:2013305-2013327 CTGCCAGGAGGGCTAGTGGCAGG + Intronic
1143175617 17:4953342-4953364 GTGAGTGAAGGGCTAGCGGTGGG + Intronic
1143592042 17:7891034-7891056 CTGGCTGAAGGCTTTGTAGTTGG - Exonic
1144750082 17:17642493-17642515 CTGGCTTGAGTGCTTGTGGTTGG + Intergenic
1145780411 17:27559375-27559397 CTAGATGAAGATCTAGTGGTTGG - Intronic
1146568451 17:33933265-33933287 CAGGGTGAAGGGATAGTGATTGG - Intronic
1146643183 17:34556455-34556477 CTGGGTGAAGAGTTAGTGGTAGG - Intergenic
1148212494 17:45817022-45817044 CTGGCTGGAGGGCCCGGGGTAGG - Intronic
1148806988 17:50268907-50268929 CTTGGTGAAGGACTCGTGGTTGG - Intergenic
1151426511 17:74034333-74034355 CTGACTGAGGGGCTTGGGGTGGG - Intergenic
1152457969 17:80426943-80426965 CAGGCTGCAGGGCAAGCGGTGGG - Intronic
1152887950 17:82863583-82863605 CTGGTTGAGGGGTTAGTGCTCGG + Intronic
1157484893 18:48079860-48079882 CTGGCTGAGGTGCCAGTGCTCGG - Intronic
1158496194 18:57957022-57957044 AGGGCTGAAGGGATACTGGTGGG + Intergenic
1158844641 18:61428849-61428871 ATGGCTGGAGGGCTGGTGGGTGG - Intronic
1163062134 19:14768423-14768445 CTGGGTGAAGGTTTAGTGGCTGG + Intronic
1164572474 19:29384492-29384514 CTGGCTGCTGGACTAGTGATGGG + Intergenic
1165247283 19:34504905-34504927 CTGGCTGCAGGGTTAGGAGTAGG + Exonic
1165776056 19:38404985-38405007 CTTGGTGAAGGGGTAGTGGAGGG + Exonic
1167475368 19:49697497-49697519 CTGGGTGAAGGGAGAGTGATTGG - Intronic
1167650799 19:50727636-50727658 CTGGGGGAAGGGCTGGTTGTTGG - Intergenic
927696626 2:25244038-25244060 CTGGCTGGAGGGCCAGCGCTGGG - Intronic
931699378 2:64897505-64897527 CTGGCAGAAGGGTTACTGGATGG - Intergenic
931793042 2:65682426-65682448 GTGGCTCAAGGACTAGGGGTGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933730461 2:85452366-85452388 GTGGCAGCAGGGCCAGTGGTGGG - Intergenic
941318238 2:164021850-164021872 CTGCCTGAAGGCATAGTGTTTGG - Intergenic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
946118806 2:217490649-217490671 CCTGCTAAAGGGCTACTGGTTGG - Intronic
947397235 2:229698164-229698186 CAGGCTGGAGTGCAAGTGGTGGG - Intronic
947611700 2:231528715-231528737 CAGGCTGAAGAGGTAGTAGTTGG + Exonic
948260862 2:236603668-236603690 CTTGCAGAAGGTCTAGTGGACGG + Intergenic
1169481630 20:5987611-5987633 CTGGGTGAAGGGCGAGTAGGTGG - Intronic
1169966855 20:11227431-11227453 ATGGCTGAAGGGTTAGTTGGAGG + Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1176220815 20:63968736-63968758 TTGGCTGAAGTGGTAGTGGTGGG - Intronic
1178758845 21:35380672-35380694 CTGGATGAGGGGCTAGGGGAGGG + Intronic
1180147237 21:45928349-45928371 CTGGCTGCAAGGCCAGGGGTTGG + Intronic
1180745181 22:18083591-18083613 GAGGCTGAGGAGCTAGTGGTGGG + Exonic
1181985508 22:26797596-26797618 CTGGCTGCAGGGGTAGTATTTGG - Intergenic
1185346540 22:50313079-50313101 CTGGCTGAAGGGCTGGATCTGGG + Exonic
952713795 3:36457858-36457880 TTGGCTGAGGGCCTTGTGGTTGG - Intronic
952931940 3:38367289-38367311 CTGGCTGAAGGGCCACAGCTGGG - Intronic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
955712718 3:61796964-61796986 CCGGGTGAAGGGTTAGTTGTTGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
960193122 3:114731079-114731101 CTGGCTGATGGTCTATTTGTTGG + Intronic
960253188 3:115480379-115480401 ATGGAACAAGGGCTAGTGGTGGG + Intergenic
964368555 3:155974646-155974668 CTGGGTCTAGGGGTAGTGGTGGG - Intergenic
965718344 3:171631579-171631601 CTGATTGCAGGGCTAGTGTTGGG + Intronic
970647371 4:18138086-18138108 CTGGCTGGAAGGCGAGTGGATGG - Intergenic
970742249 4:19251805-19251827 CTGGCTGTATAGCTGGTGGTGGG + Intergenic
978015699 4:103743306-103743328 CGGGCTGGAGGGCTAAGGGTGGG + Intergenic
978365820 4:107980350-107980372 CTGGCTGAAGAGAAAGTGTTAGG - Intergenic
981288335 4:143045822-143045844 CTGTCTGAAGAGGTTGTGGTTGG - Intergenic
986549447 5:8936196-8936218 CATGCTGGTGGGCTAGTGGTAGG - Intergenic
986841371 5:11701256-11701278 CTTGCTGATGGGGTAGTGCTAGG - Intronic
987343768 5:16960928-16960950 CTGGCTGAAGGGAATGTGCTGGG + Intergenic
988450021 5:31332587-31332609 CTGACTGAAGGAGTAGTTGTAGG + Intergenic
991296290 5:65084955-65084977 ATGGCTGAAGGACAAGAGGTGGG + Intergenic
991642381 5:68768067-68768089 CAGGATGAAGGGCCAGTGTTTGG - Intergenic
992509244 5:77416887-77416909 GTGGCTGAAGGGATAGTGAGAGG - Intronic
993165796 5:84353306-84353328 CTGGCAGAAAGGCAGGTGGTAGG + Intronic
994756657 5:103801399-103801421 CTGGTTTAAGTGCTAGTGGGCGG - Intergenic
999242175 5:150134049-150134071 CAAGCTGAAGTGCTAGTGGCTGG - Intronic
999343747 5:150796437-150796459 CTGGCTGCAGAGCTGGTGGGAGG - Exonic
999525842 5:152404853-152404875 CAGGCTGAAGAGGTAGTAGTTGG + Exonic
1001830742 5:174787209-174787231 ATGACTGAAGGGCCAGTGCTGGG + Intergenic
1001970087 5:175948601-175948623 CTGGCTGACAGCCTTGTGGTGGG + Intronic
1002247349 5:177895163-177895185 CTGGCTGACAGCCTTGTGGTGGG - Intergenic
1003559699 6:7170447-7170469 CTGGCTGAAGGGCTCAGGTTTGG + Intronic
1003636121 6:7832971-7832993 CAGGCTGAAGGGCTCTTGGCAGG + Intronic
1007335453 6:41152022-41152044 CTGGCTGCAGGACTTGGGGTTGG + Intronic
1008373404 6:50763006-50763028 CTGACTGAAGGGCTATTCATAGG - Intronic
1008661845 6:53676706-53676728 CGGGTTGAGGGGCTAGTGGAGGG + Intergenic
1011009324 6:82685955-82685977 CTGGCTGAAGTGCTTCTGGGTGG + Intergenic
1013461375 6:110378129-110378151 CATACTGAAGGGCTATTGGTGGG + Intergenic
1014530464 6:122552852-122552874 CAGTCTTTAGGGCTAGTGGTGGG + Intronic
1017347797 6:153405063-153405085 ATGGCTGCAGGGCAAGTGGAAGG + Intergenic
1021122032 7:16806714-16806736 CTGGCTTAAGACCTAGTTGTTGG + Intronic
1021138561 7:16995005-16995027 CTTGCTGAAGGGACAGTAGTAGG + Intergenic
1022795673 7:33729783-33729805 CTAGCTGAAGTGCTGGTGGCTGG - Intergenic
1025032050 7:55565735-55565757 CTGGCTGCAGGGGTGGAGGTGGG + Intronic
1027201949 7:76069520-76069542 CAGGCTGAAGAGCTTGTGGATGG + Intergenic
1029199072 7:98826775-98826797 CTGGCAGATGGGCCAATGGTGGG - Intergenic
1032411668 7:131698129-131698151 CTGGCTCCAGGGCTAGGGATTGG - Intergenic
1032912141 7:136444941-136444963 CTAGCTCACGGGCTAGAGGTCGG - Intergenic
1033796786 7:144854737-144854759 CTGGCTGTATTGGTAGTGGTAGG - Intergenic
1034499275 7:151439658-151439680 CTGACTGCAGGGCGAGGGGTTGG + Intronic
1037618556 8:20543165-20543187 CTGGGTGAAGGGGTTGTGGGCGG + Intergenic
1041823313 8:62063664-62063686 CTGTCTGAAGGGCGAGTCCTGGG + Intergenic
1045102389 8:98858561-98858583 CTGGCTGAAGGGATAGTGGGAGG + Intronic
1048284723 8:133132948-133132970 GTGGCTGCAGGGCTGGTGTTTGG + Intronic
1061084317 9:128390332-128390354 CAGGGTCAAGGGCTAGGGGTGGG - Exonic
1062025861 9:134340380-134340402 CTGGCTGAAAGGTCAGTGGGTGG - Intronic
1187725909 X:22201766-22201788 TTGGCTGCAGGGCTGGTAGTAGG + Intronic
1190762800 X:53450686-53450708 CTGGCAGAGGGGCTAAGGGTAGG + Intergenic
1191035121 X:56017202-56017224 CTGACTGAAGAGCTAGTATTAGG + Intergenic
1192151264 X:68713989-68714011 CTTGCTGAAGGGTTAGAGATAGG - Intronic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1195786349 X:108527818-108527840 CCAGCTGAAGTGGTAGTGGTTGG - Intronic
1198473411 X:136971714-136971736 CTGGCTGAAGGGTTAATGTCTGG + Intergenic
1200394417 X:155975097-155975119 CTGGCTGAAGGGCTACTGGATGG - Intergenic