ID: 901861470

View in Genome Browser
Species Human (GRCh38)
Location 1:12077419-12077441
Sequence CCGGCTTTGCAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1238
Summary {0: 1, 1: 1, 2: 22, 3: 287, 4: 927}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901861470 Original CRISPR CCGGCTTTGCAGATGGAGTA AGG Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900783354 1:4632056-4632078 CTGGCTTTGAAGACGGAGGAGGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900890964 1:5449393-5449415 CTGGCTTTGCAGATGCAGGAAGG + Intergenic
900905602 1:5554931-5554953 CCGGCTTTGCAGATAGAGGAGGG - Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
901140436 1:7025727-7025749 CCAGCTTTGGGGATGGAGTGGGG + Intronic
901263626 1:7892390-7892412 CAAGCTTTGCAGATGGAGGCAGG - Intergenic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901826031 1:11861936-11861958 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
901861470 1:12077419-12077441 CCGGCTTTGCAGATGGAGTAAGG + Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903485730 1:23688456-23688478 CCGGGATTGCAGACGGAGTCTGG + Intergenic
903508043 1:23852744-23852766 CCGGGATTGCAGATGGAGTCTGG + Intronic
903633806 1:24798913-24798935 CCGGGATTGCAGACGGAGTCTGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
903894638 1:26595745-26595767 CCGGGATTGCAGACGGAGTCTGG + Intergenic
904784894 1:32975567-32975589 CCGGGATTGCAGACGGAGTCTGG - Intergenic
905235786 1:36546968-36546990 TCAGCTTTGAAGATGGAGGACGG + Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905526355 1:38642943-38642965 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
906136046 1:43501552-43501574 CCGGGATTGCAGACGGAGTCTGG + Intergenic
906329852 1:44876052-44876074 CCGGGATTGCAGACGGAGTCTGG + Intronic
906353276 1:45081579-45081601 CCGGGATTGCAGACGGAGTCTGG + Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908022202 1:59909483-59909505 CTGGCTTTGAAGATGAAGGAGGG + Intronic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909369506 1:74867699-74867721 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910802433 1:91159574-91159596 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
910980059 1:92951253-92951275 CTGGCTTTGAAGTTGGAGAAAGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911325969 1:96470320-96470342 CCGGGATTGCAGACGGAGTCTGG - Intergenic
911351905 1:96763305-96763327 CCGGAATTGCAGACGGAGTCTGG - Intronic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912024542 1:105151481-105151503 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
912844144 1:113064104-113064126 CCGGGATTGCAGACGGAGTCTGG - Intergenic
913022916 1:114805058-114805080 CCGGGATTGCAGACGGAGTCTGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
914392068 1:147232767-147232789 CCGGGATTGCAGATGGTGTCTGG + Intronic
914468440 1:147950660-147950682 CCGGGATTGCAGACGGAGTCTGG - Intronic
914965924 1:152256876-152256898 CCGGGATTGCAGACGGAGTCTGG - Intergenic
915647320 1:157282489-157282511 TTGGCCTTGAAGATGGAGTAAGG - Intergenic
915663329 1:157422021-157422043 GTGGCCTTGAAGATGGAGTAAGG + Intergenic
916267045 1:162901009-162901031 CTGGCTTTGGAGATGGAGAAAGG - Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916632885 1:166635917-166635939 CTGGCTTTGCCCATGGAGAAAGG - Intergenic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916807949 1:168278560-168278582 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
916908441 1:169316687-169316709 GTGGCTTTGAAGATGGAGAAAGG + Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917205839 1:172571327-172571349 CCGGGATTGCAGACGGAGTCTGG + Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918399228 1:184146967-184146989 CTAGCTTTGCTGATGGAGGAAGG - Intergenic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918442054 1:184577292-184577314 CTGGCGTTGAAGATGGAGAAAGG + Intronic
919423783 1:197405344-197405366 CCGGGATTGCAGATGGAGTCTGG + Intronic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
920451400 1:206063660-206063682 CCGGGATTGCAGACGGAGTCTGG + Intronic
921043806 1:211459995-211460017 CCGGGATTGCAGACGGAGTCTGG + Intergenic
922101810 1:222483217-222483239 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922102346 1:222487267-222487289 CCGGGATTGCAGACGGAGTCTGG + Intergenic
922262892 1:223958338-223958360 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
922996460 1:229966151-229966173 CTGGCTTTGAAGGTGGAGAAAGG + Intergenic
923468361 1:234268182-234268204 CCGGGATTGCAGACGGAGTCTGG - Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923589766 1:235308743-235308765 CCGGGATTGCAGACGGAGTCTGG + Intronic
924213103 1:241790976-241790998 CTGGCTTTGAAGATGAAGGAAGG - Intronic
924344730 1:243063339-243063361 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
924530353 1:244888641-244888663 CTGGCTTTGAACATGGAGGAAGG + Intergenic
924718309 1:246599453-246599475 CTGGCCTTGAAGATGGAGGAAGG - Intronic
924738589 1:246781084-246781106 GCGGCTTTGAAGATGGAGGGAGG + Intergenic
1063091227 10:2867632-2867654 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1063894004 10:10660027-10660049 CTGGCTTTGAAGATAGAGAAAGG + Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1065698355 10:28401164-28401186 CTGGCCTTGGAGATGGAGGAAGG - Intergenic
1065794738 10:29295797-29295819 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1065934666 10:30510706-30510728 CCAACTTTGCTGAGGGAGTAGGG - Intergenic
1065947997 10:30624934-30624956 CTGGCTGTGAAGATGGAGTAAGG + Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066515868 10:36159863-36159885 CCGGCTTTGAAGATGAGGTAAGG + Intergenic
1066731602 10:38441735-38441757 CTGGCTTTGAAGATGGAATCAGG + Intergenic
1067007802 10:42681179-42681201 CTGGCTTTGAAGATGCAGTTAGG - Intergenic
1067026348 10:42846970-42846992 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068286159 10:54938868-54938890 CTGGCTTTGAAAATGGAGAAAGG + Intronic
1068780755 10:60916934-60916956 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069052815 10:63812191-63812213 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1069072949 10:64008877-64008899 CTGGCATTGCAGATCAAGTAGGG - Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1069945511 10:71982846-71982868 CCTGCTTTACAGATGAAGTACGG + Intronic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1070658522 10:78288093-78288115 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1070684267 10:78469411-78469433 CCGGGATTGCAGATGGAGTCTGG - Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071668764 10:87587395-87587417 CCGGCTTTGAAGATGGCAGAGGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072056466 10:91762496-91762518 CTGGCTTTGTAGAATGAGTAAGG - Intergenic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1072180195 10:92974834-92974856 CCGGGATTGCAGATGGAGTCTGG + Intronic
1072291600 10:93970308-93970330 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1072911889 10:99509497-99509519 CTGGCTTTGAAGATGGAGGCAGG + Intergenic
1073080293 10:100855530-100855552 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1073179703 10:101576226-101576248 CTGGCTTTGAAGATGGGGAAAGG - Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074471007 10:113726705-113726727 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1075029117 10:119009321-119009343 CTGGCTTTGAAGATGGAGTTGGG + Intergenic
1075106061 10:119540906-119540928 CCCACTTTGCAGGTGGAGAAAGG + Intronic
1075181560 10:120215769-120215791 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1075264362 10:120988202-120988224 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075336544 10:121613033-121613055 CTGGCTTTGAAAATGGAGTGGGG - Intergenic
1075448612 10:122531223-122531245 TGGGCTTTGAAGATGGAGGAAGG + Intergenic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075515653 10:123106044-123106066 CTGGCTTTGAAGATGCAGGATGG + Intergenic
1075580066 10:123610727-123610749 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1075607225 10:123820746-123820768 CTGGCTTTGAAGATGGATAAAGG - Intronic
1075842678 10:125518037-125518059 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076120470 10:127932972-127932994 CGGGCTTTAAAGATGGAGGAAGG - Intronic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076947192 10:133659452-133659474 CCGGCTCTGCAAAGGGACTAGGG + Intergenic
1077252514 11:1566837-1566859 CCGGGTGGGCAGGTGGAGTAGGG + Intronic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1077482434 11:2822101-2822123 CTGGCTTTGAAGACGGAGGAGGG + Intronic
1078463608 11:11533900-11533922 CCTGCCTGGCAGATGGAGTAGGG + Intronic
1078565345 11:12409599-12409621 CTGGCTTTTAAGATGGAGTAAGG + Intronic
1078622047 11:12917234-12917256 CTGGCTTTGAAAATGGAGCAAGG + Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079946671 11:26751540-26751562 GTGGCTTTGAAGATGGAGAAAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080620770 11:33985822-33985844 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081350534 11:42046314-42046336 CCGCCTTTGAAGATGGACAAAGG + Intergenic
1081602569 11:44505464-44505486 CCACCTTTGGAGATGGAGGAAGG + Intergenic
1082262148 11:50084731-50084753 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1082766789 11:57175172-57175194 CTAGCTTTGGAGATGGAGGAAGG - Intergenic
1082844910 11:57717430-57717452 CCGGGATTGCAGACGGAGTCTGG - Intronic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083042165 11:59699315-59699337 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1083130585 11:60621645-60621667 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084702369 11:70795796-70795818 CTGGCTTTGGAGACGGAGGAAGG + Intronic
1085480759 11:76821078-76821100 CCGGGATTGCAGATGGAGTCTGG + Intergenic
1085503955 11:77045325-77045347 TCGGTTTTGGAGATGGAGGAAGG - Intergenic
1085822101 11:79804281-79804303 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1086017097 11:82181471-82181493 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1086122727 11:83317524-83317546 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1086365957 11:86110207-86110229 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1086881368 11:92157155-92157177 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1087332930 11:96805619-96805641 CTGGCTTTGAAGACGGAGGATGG - Intergenic
1087351304 11:97036046-97036068 CTGGTTTTGAAGATTGAGTAAGG + Intergenic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1087834547 11:102859490-102859512 ACTGCTTTGCATATGGAGTATGG - Intergenic
1087956974 11:104300430-104300452 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1088257003 11:107912073-107912095 CCGGGATTGCAGACGGAGTCTGG + Intronic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088659059 11:112027627-112027649 CCGGGATTGCAGACGGAGTCTGG - Intronic
1088968693 11:114751922-114751944 ATGGCTTTGAAGATGGAGAATGG + Intergenic
1089068815 11:115682718-115682740 CTGGCTTGGAAGATGGAGGAAGG + Intergenic
1089082357 11:115787453-115787475 CCAGCTTTGCAGATGGAGCTGGG - Intergenic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089585763 11:119508610-119508632 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1089625281 11:119747221-119747243 CTGGCTTTGAAAATGGAGTGGGG - Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090819109 11:130325217-130325239 CTGGCTTTCAAGATGGAATAAGG - Intergenic
1091237300 11:134030931-134030953 CCGGCTGTGCAGGTAGAGGACGG + Intergenic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1091586089 12:1817752-1817774 CCGGGATTGCAGACGGAGTCTGG + Intronic
1091993086 12:4972670-4972692 CAGACTTTGTAGATGAAGTAAGG + Intergenic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093496365 12:19762735-19762757 CTGGCTTTGGAGATAGAGGAAGG + Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093549832 12:20394986-20395008 CCTTCTTTCCATATGGAGTATGG - Intronic
1094208794 12:27868782-27868804 GCAGCTTTTCAGATGGAGTTTGG + Intergenic
1094239178 12:28201755-28201777 CCGGGATTGCAGACGGAGTCTGG - Intronic
1094670472 12:32563728-32563750 CCGGGATTGCAGATGGAGTCTGG - Intronic
1094718655 12:33038744-33038766 TTGGCTTTGGAGATGGAGAAAGG - Intergenic
1095570960 12:43684637-43684659 CCGGGATTGCAGATGGAGTCTGG + Intergenic
1096093132 12:48916327-48916349 CCGGGATTGCAGACGGAGTCTGG - Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097527736 12:60759388-60759410 CTAGCTTTGAAGATGGAGAAGGG - Intergenic
1097583944 12:61492729-61492751 CTGGCTTTGAAGATGGAACAAGG + Intergenic
1097589536 12:61557284-61557306 CTGGCTTTGGAGATGGATGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1098883622 12:75941311-75941333 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099182557 12:79485014-79485036 TTGGCTTTGAAGATGGAGCAAGG - Intergenic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1101878409 12:108610235-108610257 GAGGCTTTGCAGAGGGCGTAGGG - Intergenic
1102089221 12:110172655-110172677 CCGGGATTGCAGATGGTGTCTGG + Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102386751 12:112516482-112516504 CCGGCTTTGAAGATGGACAGAGG - Intergenic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103038465 12:117675364-117675386 CCTGATTTGCAGATGGAGACTGG - Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103456921 12:121075607-121075629 CGGGATTTGCAGACGGAGTCTGG + Intergenic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1103951354 12:124553155-124553177 CTGGCTTTGAGGATGGAGAAGGG - Intronic
1104053982 12:125215440-125215462 CTGGCTTTGAAGATGAAGAAGGG - Intronic
1104074783 12:125379365-125379387 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105006035 12:132721149-132721171 CCGGCTTTGCCAATGGAGCCTGG - Exonic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1105980689 13:25513684-25513706 CCGGGATTGCAGACGGAGTCTGG - Intronic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106495118 13:30269350-30269372 CCGGGATTGCAGACGGAGTCTGG + Intronic
1106670652 13:31901056-31901078 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1106735373 13:32583674-32583696 CTGGCTTTGCGGATGGAGGAAGG + Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1106887673 13:34207240-34207262 CTGGCTTTTAAGGTGGAGTAAGG - Intergenic
1107366248 13:39680741-39680763 CTGGCTTGGAAGATGGAGGAAGG - Intronic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1107788367 13:43976801-43976823 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108268277 13:48733696-48733718 CTGGCTTTGAAAATGGAGAAGGG + Intergenic
1108608434 13:52063341-52063363 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1108610400 13:52079568-52079590 CCGGGATTGCAGACGGAGTCTGG + Intronic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110427726 13:75388071-75388093 CCGGCTTTGCAGGTGGAAGAAGG - Intronic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110506618 13:76294957-76294979 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1110600605 13:77368218-77368240 CTGGCTTTGTAGAAGGAGTTAGG - Intergenic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110838303 13:80110423-80110445 CTGGCTTGGAAGATGGAGTAAGG + Intergenic
1110877133 13:80523788-80523810 TTGGCTTTGCAGAATGAGTAAGG + Intergenic
1111311128 13:86487626-86487648 CTGGCTTTAAAGATGGGGTATGG - Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1112866112 13:103900766-103900788 CTGGCTTTGCAGAATGAGTTTGG - Intergenic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113343975 13:109455713-109455735 CTGGCTTTCAAGATGGAGAAAGG - Intergenic
1113909457 13:113835231-113835253 CCGTCTATGCAGGTGGAGAAGGG + Intronic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1113984336 13:114301851-114301873 ACGGCTTTCCAGAAGGAGTGAGG + Exonic
1114174671 14:20309611-20309633 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1114198985 14:20505582-20505604 CCGGGATTGCAGACGGAGTCTGG + Intronic
1114345915 14:21794905-21794927 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1115259573 14:31437901-31437923 CCGGGATTGCAGACGGAGTCTGG - Intronic
1115495710 14:34002418-34002440 CTGGCTTTGACGATGGAGGAAGG + Intronic
1115847790 14:37556264-37556286 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116072627 14:40068150-40068172 CCTGCTTTGAAGATAGAGAAAGG - Intergenic
1116192164 14:41675330-41675352 CCGGGATTGCAGACGGAGTCTGG - Intronic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1117152270 14:52901617-52901639 CTGGCTTTGAAGATAGAGGAAGG + Intronic
1117411830 14:55456999-55457021 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1118009218 14:61592369-61592391 CCAGCTTTGAAGGTGGAGGAAGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118184045 14:63522212-63522234 CCGGGATTGCAGACGGAGTCTGG + Intronic
1118209458 14:63751785-63751807 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1118517849 14:66546498-66546520 CCGGGATTGCAGATGGAGTCTGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119433170 14:74581508-74581530 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119595108 14:75925778-75925800 CCGGGATTGCAGACGGAGTCTGG - Intronic
1119680364 14:76587880-76587902 CAGGCTTTGAAGATGGAATGGGG - Intergenic
1119722135 14:76898596-76898618 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1120186017 14:81394706-81394728 CTGGCTTTGGAGATAGAGGAAGG + Intronic
1120219816 14:81719488-81719510 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120383310 14:83810686-83810708 CTGGCTTTGAAGATGGAATTAGG - Intergenic
1120547706 14:85830380-85830402 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1121143019 14:91558074-91558096 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1121163124 14:91764007-91764029 CAGGCTTTGCAGAATGAGTCAGG - Intronic
1121531473 14:94657692-94657714 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1121965756 14:98303526-98303548 CTGGCTTTGCAGAATGAGTTAGG + Intergenic
1122238094 14:100344351-100344373 CCGGGATTGCAGACGGAGTCTGG + Intronic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122373183 14:101240630-101240652 CTGGCTTTGAAGACGGAGGATGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1122921467 14:104882128-104882150 CCGGCTTCTCAGAGGGAGTCAGG + Intronic
1122957875 14:105079778-105079800 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123445883 15:20329812-20329834 CAGGCTTTGAGGATGGAGGAAGG - Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1124335194 15:28850368-28850390 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1126075060 15:44901086-44901108 CCAGCTTTCAAGATGGAGGAAGG - Intergenic
1126083303 15:44986735-44986757 CCAGCTTTCAAGATGGAGGAAGG + Intergenic
1126290625 15:47072926-47072948 CAGGCTTTGAAAATGGAGGAAGG - Intergenic
1126318113 15:47392496-47392518 CTGGCTTTGAAGACGGAGGAAGG + Intronic
1126401280 15:48273269-48273291 CTGGCTTTGAAGATTGAGAAAGG - Intronic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1126517315 15:49551009-49551031 CCGGGATTGCAGACGGAGTCTGG - Intronic
1126729547 15:51668731-51668753 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1127783084 15:62333018-62333040 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1127824460 15:62690740-62690762 CCGGGATTGCAGACGGAGTCTGG - Intronic
1127874193 15:63098543-63098565 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128490368 15:68136329-68136351 CCGGGATTGCAGACGGAGTCTGG - Intronic
1128625729 15:69201009-69201031 CTGGCTTTGAAGATGAAGGAGGG - Intronic
1128929466 15:71691104-71691126 CGGGCTTTGCAGATGAAGGAAGG + Intronic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1129118944 15:73383261-73383283 AGGGCTTTGAAGATGGAGGAAGG + Intergenic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1130959672 15:88651515-88651537 CTGGCTTTGAAGATGGAGGGAGG - Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131479492 15:92769047-92769069 CCGGGATTGCAGACGGAGTCTGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1132037086 15:98493534-98493556 CCGGGATTGCAGACGGAGTCTGG - Intronic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1132300882 15:100774723-100774745 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132921935 16:2400490-2400512 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1132992367 16:2802609-2802631 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133481263 16:6172979-6173001 CTGGCTTCGAAGATGGAGAAAGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134471934 16:14533133-14533155 CCGGGGTTGCAGACGGAGTCTGG - Intronic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1134854413 16:17506537-17506559 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1136016867 16:27406059-27406081 CCCGCTTGGCAGATGGGGAAAGG - Intronic
1137020393 16:35420022-35420044 CAGGCTGTGCAGATTGAGCAGGG + Intergenic
1137283747 16:46999726-46999748 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1137502993 16:49025611-49025633 CCAGCTTTGAAGTTGGAGAAAGG - Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1138028109 16:53538845-53538867 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1138639631 16:58374155-58374177 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1139309457 16:66016193-66016215 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1139374568 16:66488739-66488761 CTGGCTTTTAAGATGGAGGAAGG + Intronic
1139378274 16:66514387-66514409 CCGGGATTGCAGACGGAGTCTGG + Intronic
1139509668 16:67419960-67419982 TGGGCTTTGAAGATGGAGGAAGG + Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140677068 16:77342939-77342961 CTGGCTTTGAAGATGAAGGAGGG + Intronic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140787062 16:78352480-78352502 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141329980 16:83102094-83102116 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1141354684 16:83334098-83334120 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1141471780 16:84243573-84243595 CAGGCTTTGAAGATGGAGAAGGG - Intergenic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1141478227 16:84288224-84288246 GTGGCTTTGGAGATGGAGGAAGG - Intergenic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1141918743 16:87120591-87120613 CCATCTTTGCAGCTGGAGAAAGG + Intronic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142198044 16:88747869-88747891 CCGGCTCTGGAGATGGAGGGAGG + Intronic
1142657516 17:1403747-1403769 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143277313 17:5721628-5721650 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143823862 17:9588320-9588342 CCATCTTTGCAGATGGACAAGGG + Intronic
1144217660 17:13070591-13070613 CTGGCTTTGAAGATGCAGAAAGG + Intergenic
1144515519 17:15915193-15915215 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1144613410 17:16745912-16745934 CCGGCTTTCCAGAAGGAGTGAGG - Intronic
1145133074 17:20375988-20376010 CCGGCTTTCCAGAGGGAGTGAGG - Intergenic
1145158305 17:20557222-20557244 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147008966 17:37428455-37428477 CTGGCTTTGAGGATGGAGAAAGG - Intronic
1148404148 17:47397280-47397302 CCGGGATTGCAGACGGAGTCTGG + Intronic
1148406343 17:47420215-47420237 CCGGGGTTGCAGACGGAGTCTGG + Intronic
1148862576 17:50612378-50612400 CCGGCTTCCCAGATGGAGGGAGG + Intronic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149286773 17:55173920-55173942 CTGGCTTTGCAGGTGGATAAAGG - Intergenic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149780765 17:59394816-59394838 CCGGGATTGCAGACGGAGTCTGG - Intronic
1150380522 17:64716291-64716313 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1151139509 17:71977981-71978003 TTGGCTTTGAAGATGGAGAAGGG + Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1152172582 17:78762757-78762779 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1152355477 17:79804811-79804833 CCGGTTTAGCAGAGGGTGTAGGG + Intergenic
1153007759 18:512748-512770 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1153117665 18:1679135-1679157 CTGGCTTTGAAGATGGGGAAAGG - Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153966623 18:10188755-10188777 CCGGCTTTGTAGAATGAGTCTGG - Intergenic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154074588 18:11187791-11187813 CCAGCTCGGCAGATGGAGGAGGG + Intergenic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1154398452 18:14011578-14011600 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155361792 18:25010507-25010529 CCAGCTTTGAAGATAGAGGAAGG + Intergenic
1155437024 18:25824192-25824214 CTGGCTTTGAAGATGGAGGCAGG - Intergenic
1155745260 18:29348601-29348623 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156326460 18:36078378-36078400 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1156829716 18:41477273-41477295 CCGGCATTGAAGATGGAAGAAGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157056548 18:44235656-44235678 CTAGCTTTGCAGATAGAGGAAGG - Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157502107 18:48198572-48198594 CAGGCTTTGAAGATGAAGGAAGG - Intronic
1157629597 18:49081231-49081253 CCGGGATTGCAGACGGAGTCTGG - Intronic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160143121 18:76343521-76343543 CCGTCTCTGCTGATGTAGTAGGG - Intergenic
1160182105 18:76645199-76645221 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1160916699 19:1499976-1499998 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1161010100 19:1955769-1955791 CCGGCTTTGCAGATGGAGCCCGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161790103 19:6355091-6355113 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162723550 19:12676366-12676388 CCTGCCTTGCAGATGGGGCAGGG - Intronic
1163223337 19:15937264-15937286 CTGTCCTTGCAGAGGGAGTAGGG - Intergenic
1163441552 19:17324659-17324681 CCGGCTTTGGGGATAGGGTAGGG - Intronic
1163904217 19:20137546-20137568 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1163913009 19:20214165-20214187 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1165602363 19:37065469-37065491 CTGGCTTTTGAGATGGAGGAAGG + Intronic
1165727832 19:38124729-38124751 CCGGGATTGCAGACGGAGTCTGG - Intronic
1165768412 19:38364649-38364671 CCGGGATTGCAGACGGAGTCTGG - Intronic
1165852289 19:38856410-38856432 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1166191491 19:41179780-41179802 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1166284066 19:41812776-41812798 CTCGCTTTGAAGATGGAGGAAGG - Intergenic
1166418146 19:42610998-42611020 CCGGGATTGCAGAAGGAGTCTGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166820539 19:45576694-45576716 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1167540774 19:50086023-50086045 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1167975397 19:53222538-53222560 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1168014415 19:53560720-53560742 CAGGCTTTGCTGATGGAAGAAGG - Intronic
1168189378 19:54726734-54726756 CGGGCTTTGAAGATGGGGGAAGG + Intronic
1168191387 19:54740910-54740932 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
1168193656 19:54757538-54757560 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
1168572508 19:57482847-57482869 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1168634144 19:57982252-57982274 TGAGCTTTGCAGATGGAGGAAGG - Intronic
1168658184 19:58146819-58146841 CCGGGATTGCAGACGGAGTCTGG + Intronic
1202646347 1_KI270706v1_random:145424-145446 CAGGCTTTGAAGATGCAGTTAGG - Intergenic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
925322092 2:2980099-2980121 CTGGCTTTGCAGAATGAGTTAGG - Intergenic
925481944 2:4285255-4285277 CTGGCTTTGAAGATGAAGGAGGG + Intergenic
926056964 2:9779326-9779348 ACGGCTTTGAAGATGGAGGGAGG + Intergenic
927676746 2:25111778-25111800 CTGGCTTTGAAGATAGAGAAGGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927747115 2:25633432-25633454 CCGGGATTGCAGACGGAGTCTGG + Intronic
927777160 2:25911334-25911356 CCGGGATTGCAGACGGAGTCTGG - Intergenic
927833449 2:26371588-26371610 CCGGGATTGCAGACGGAGTCTGG - Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928363016 2:30680728-30680750 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
928888702 2:36179584-36179606 CCGGGATTGCAGACGGAGTCCGG + Intergenic
929062148 2:37933499-37933521 CCGGGATTGCAGACGGAGTCTGG - Intronic
929110548 2:38402964-38402986 CCGGGATTGCAGACGGAGTCTGG + Intergenic
929238444 2:39628917-39628939 CCGGGATTGCAGACGGAGTCTGG - Intergenic
929448005 2:42015334-42015356 CCGGGATTGCAGACGGAGTCTGG - Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930503374 2:52252565-52252587 TCTGCTTTGCAAATGGAGAAGGG - Intergenic
930665694 2:54096560-54096582 CCGGGATTGCAGATGGAGTCTGG - Intronic
930723788 2:54663485-54663507 TCGGCTTTGGAAATGTAGTAGGG - Intronic
930769251 2:55115326-55115348 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
930978646 2:57495003-57495025 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931191955 2:60010218-60010240 CCGGCTTTGAAAATGGAGGAAGG + Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932710938 2:74062148-74062170 CCGGGATTGCAGACGGAGTCTGG - Intronic
932829475 2:74975113-74975135 CTGGCTTTGAAGATGGAGGGGGG + Intergenic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932872135 2:75412540-75412562 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
933449192 2:82424743-82424765 CTGGCTTTGAAGTTGGAGGAAGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934509493 2:94925863-94925885 CTGGCTTTGAAGATGCAGTTAGG - Intergenic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935061420 2:99611523-99611545 CAGGCTTTGCTGATGGAGAGGGG + Intronic
935072039 2:99703243-99703265 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935082389 2:99810870-99810892 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935674442 2:105582062-105582084 CTGGCTTTGAAGATCGAGGAAGG + Intergenic
935679612 2:105624653-105624675 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
937281163 2:120718141-120718163 TTGGCTTTGCAGATGTAGGAAGG - Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937426793 2:121806648-121806670 CTGGCATTGAAGATGGAGGAAGG + Intergenic
937519737 2:122697741-122697763 CTGGCTTTGAAGATGGAGATAGG - Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938829234 2:135034535-135034557 CCGGGATTGCAGACGGAGTCTGG - Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939009157 2:136825456-136825478 CAGGCTTTGAAGGTGGAGGAAGG - Intronic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939478334 2:142715493-142715515 AAGGCTTTGAAGATGGAGGAAGG - Intergenic
939949688 2:148455282-148455304 CAGGGTTTGGGGATGGAGTATGG - Intronic
940071301 2:149691041-149691063 CTGGCTTTGAAGATGAAGCAAGG - Intergenic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
940652528 2:156452281-156452303 CCGGGATTGCAGACGGAGTCTGG - Intronic
940817397 2:158311199-158311221 CCGGGATTGCAGACGGAGTTTGG - Intronic
940867332 2:158830381-158830403 CTGGCTTTGAAGATGGATTAAGG - Intronic
941079734 2:161046531-161046553 CCAGCTTTGAAAATGGAGCAAGG + Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
941768612 2:169326484-169326506 CCGGGATTGCAGACGGAGTCTGG + Intronic
941786513 2:169505223-169505245 CCGGGATTGCAGACGGAGTCTGG + Exonic
941849842 2:170168596-170168618 CTGGCTTTGAAGGTGGAGAAGGG + Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943411605 2:187556168-187556190 CCGGGATTGCAGACGGAGTCTGG + Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
943919397 2:193683665-193683687 CTGGCTTTGCAGATTGAGTTAGG + Intergenic
943976529 2:194485479-194485501 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
944157478 2:196622457-196622479 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
944501410 2:200364082-200364104 CAGGCTTTGAAGATGGGGGAAGG + Intronic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944862514 2:203828512-203828534 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945316769 2:208378100-208378122 CCGGGATTGCAGACGGAGTCTGG - Intronic
945755262 2:213837897-213837919 CTGGCTTTGAAGATGAAGGAAGG + Intronic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
946965033 2:225028274-225028296 CTGGCTTTGAAGATGAAGGAAGG + Intronic
947256683 2:228173562-228173584 CTAGCTTTGTAGATGGAGAAAGG + Intronic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
947457741 2:230270996-230271018 CAGGCTTTGAAGATGGAAGAAGG + Intronic
947468080 2:230372010-230372032 CAGGCTTTGAAGATGGAAGAGGG + Intronic
947816456 2:233040696-233040718 TGGGCTTTGCAGATGGAGGGAGG + Intergenic
947950351 2:234141790-234141812 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948651768 2:239450105-239450127 CCGGGATTGCAGACGGAGTCTGG - Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169482720 20:5999898-5999920 CTGGCTTTGCAGATGAGGGAAGG + Intergenic
1169718167 20:8644063-8644085 CCGGGATTGCAGACGGAGTCTGG + Intronic
1169885737 20:10395506-10395528 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170413902 20:16120230-16120252 CCGGCTTTGGAGATGGAGAATGG - Intergenic
1170517619 20:17148384-17148406 CTGGCTTTGAATATGGAGAAAGG - Intergenic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1171848599 20:30292379-30292401 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1171951514 20:31426568-31426590 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1171957613 20:31472130-31472152 CCGGGATTGCAGACGGAGTCTGG - Intronic
1172051743 20:32122896-32122918 CCGGGATTGCAGACGGAGTCTGG - Intronic
1172141058 20:32723402-32723424 CCGGGATTGCAGACGGAGTCTGG + Intronic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172199501 20:33115231-33115253 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1172258229 20:33537214-33537236 CCGGGATTGCAGACGGAGTCTGG - Intronic
1172575162 20:36002124-36002146 CCGGGATTGCAGACGGAGTCCGG - Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1172722666 20:37012131-37012153 CCGGGATTGCAGACGGAGTCTGG + Intronic
1172728772 20:37069106-37069128 CCGGGATTGCAGACGGAGTCTGG + Intronic
1172812836 20:37662042-37662064 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1172907123 20:38378438-38378460 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173273284 20:41555979-41556001 CCGGGATTGCAGACGGAGTCTGG - Intronic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174550967 20:51361257-51361279 CTGGCTTGGTAGATGGAGGAAGG - Intergenic
1175177829 20:57124015-57124037 CCGGCTTTGAAGACAGAGGAAGG + Intergenic
1175283747 20:57822642-57822664 CTGGCATTGCAGATCAAGTAAGG + Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1175495971 20:59414503-59414525 CTGGCTTGGAAGATGGAGGATGG - Intergenic
1175508558 20:59505210-59505232 CCAGCTTTGAGGATGGAGGAAGG - Intergenic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1176605525 21:8827334-8827356 CAGGCTTTGAAGATGCAGTTAGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177573841 21:22924923-22924945 CTAGCTTTGAAGATGGAGTAAGG + Intergenic
1178034274 21:28563478-28563500 CCGGGTTTGCAGACGGAGTCTGG + Intergenic
1178258114 21:31073962-31073984 CTGGCTTTGAAGATGGAGGGAGG - Intergenic
1178751512 21:35308610-35308632 CCGGCTTTGAGGATGGAGGAAGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179147252 21:38778929-38778951 CTGGCATTGAAGATGGAGGATGG + Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179240090 21:39582197-39582219 CTGGCTTTGAAGATGCAGGAGGG + Intronic
1179533887 21:42038989-42039011 CTGGCCTTGAAGATGGAGGAGGG + Intergenic
1180347822 22:11718939-11718961 CAGGCTTTGAAGATGCAGTTAGG + Intergenic
1180355600 22:11837044-11837066 CTGGCTTTGAAGATGCAGTTAGG + Intergenic
1180382653 22:12155280-12155302 CTGGCTTTGAAGATGCAGTTAGG - Intergenic
1180739393 22:18042114-18042136 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1181794705 22:25297783-25297805 CTGGCTTTGCAGAATGAGTTAGG - Intergenic
1181834690 22:25594338-25594360 CTGGCTTTGCAGAATGAGTTAGG - Intronic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182484665 22:30632218-30632240 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1183430715 22:37763957-37763979 CAGGCTTTGAAGATGAAGGAAGG - Intronic
1184169560 22:42750974-42750996 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1184249409 22:43251593-43251615 CTGGCTCTGCAGGTGGAGAAGGG + Intronic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949204141 3:1417686-1417708 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
949551262 3:5114381-5114403 CCGGGATTGCAGACGGAGTCTGG - Intergenic
949566717 3:5252039-5252061 CCTGCTTTGTAGATGAAGAAAGG - Intergenic
949570105 3:5284451-5284473 CCGGGATTGCAGACGGAGTCTGG - Intergenic
949853216 3:8439320-8439342 CCGGGATTGCAGACGGAGTCTGG + Intergenic
949988645 3:9559665-9559687 CCGGGATTGCAGACGGAGTCTGG + Intergenic
949989805 3:9569717-9569739 CCGGGATTGCAGACGGAGTCTGG + Intergenic
950060710 3:10069730-10069752 CCGGGATTGCAGACGGAGTCTGG + Intronic
950819402 3:15742005-15742027 CCGGGATTGCAGACGGAGTCTGG + Intronic
950874283 3:16256029-16256051 CCTGCTTTGCACATGGACCAAGG - Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951158580 3:19386751-19386773 GCTGCTTTTCAGATGGATTATGG + Intronic
951550645 3:23872100-23872122 CCGGGATTGCAGACGGAGTCTGG - Intronic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953294250 3:41696893-41696915 CTGGCTTTGAAGATGGAATAAGG + Intronic
953373695 3:42410994-42411016 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953652874 3:44821851-44821873 CCGGGATTGCAGACGGAGTCTGG - Intronic
953857519 3:46511441-46511463 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
953900935 3:46843557-46843579 GCGGCTTTGAAGATGGAAGAAGG + Intergenic
954162621 3:48733775-48733797 CCGGGATTGCAGACGGAGTCTGG + Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
955169573 3:56550194-56550216 TTGGCTTTGAAGATGGAGAAGGG - Intergenic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955979426 3:64509800-64509822 CTGGCTTTGCAGATAGAAGAAGG + Intergenic
956107709 3:65838012-65838034 CCGGCTTTGAAGTTGTACTACGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
959087688 3:101868748-101868770 CTGGCTTTGAGGATGGAGCAAGG + Intergenic
959112875 3:102142954-102142976 CTGGCTTTGCAGATAGAGGAAGG - Intronic
959266044 3:104140101-104140123 CTGGCTTTGAATATGGAGTAAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959586142 3:108026607-108026629 CCGGGATTGCAGACGGAGTCTGG - Intergenic
959683660 3:109123641-109123663 CCGGGATTGCAGACGGAGTCTGG + Intergenic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
959750227 3:109826048-109826070 CCTGCTTTGCATATCGAGAAAGG - Intergenic
959848708 3:111063420-111063442 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
960526816 3:118719114-118719136 CCGGGATTGCAGACGGAGTCTGG - Intergenic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960817441 3:121688454-121688476 CCGGGATTGCAGACGGAGTCTGG + Intronic
960866185 3:122202146-122202168 CCGGGATTGCAGACGGAGTCTGG - Intronic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961784620 3:129340525-129340547 CCGGGATTGCAGACGGAGTCTGG - Intergenic
961789236 3:129364066-129364088 CCGGGATTGCAGACGGAGTCTGG - Intergenic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
962088090 3:132212975-132212997 CGGGCTTTAAAGATGGAGGAAGG + Intronic
962572058 3:136722960-136722982 CCGGGATTGCAGACGGAGTCTGG + Intronic
963006797 3:140734035-140734057 CTGGCTTTGAAGTTGGAGGAAGG - Intergenic
963020063 3:140864288-140864310 CCGGCTTTGCACATGACCTATGG + Intergenic
963249204 3:143087315-143087337 CCGGGATTGCAGACGGAGTCTGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963530643 3:146469732-146469754 CCGGCTTTGCTGCTGGAGCGCGG + Intronic
963998092 3:151734907-151734929 CTGGCTTGGCAGAAAGAGTATGG - Intronic
964219747 3:154329601-154329623 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964919452 3:161878552-161878574 CTGGCTTTGCAGATTGAGTTAGG - Intergenic
965186155 3:165467040-165467062 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965651664 3:170939711-170939733 CTGGCTTTGAAGATTGAGAAAGG - Intergenic
965856335 3:173092556-173092578 CTGGCTTTGAAGACGGAGGAAGG + Intronic
966015645 3:175133449-175133471 CCGGGATTGCAGACGGAGTCTGG - Intronic
966018567 3:175176723-175176745 CTGGCTTTGAGGATGGAGTAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967524154 3:190472970-190472992 CCGGGATTGCAGACGGAGTCTGG + Intergenic
967735580 3:192948367-192948389 CTGGCTTTGGTGATGGAGAAAGG - Intergenic
967851354 3:194084944-194084966 CTGGCTTTGAAGATAGAGAAAGG - Intergenic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
968121398 3:196128427-196128449 CTGGCTTTGAAGATGAAGAAGGG + Intergenic
968431258 4:560419-560441 CCTGCCTTGCAGCTGGAATAGGG + Intergenic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969197332 4:5573417-5573439 CTGGCTTTGAAGATGAAGAAAGG + Intronic
969431402 4:7156934-7156956 CTGGCTTTGAAGGTGGAGTGAGG + Intergenic
970472853 4:16394028-16394050 CCGGGATTGCAGATGGTGTCTGG - Intergenic
970527934 4:16951248-16951270 CTGGCTTTGAAGATGCAGGAAGG + Intergenic
970656803 4:18240227-18240249 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971795335 4:31219683-31219705 CCGGCTTTGAAGATGGAGAAAGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972080065 4:35139441-35139463 CTAGCTTTGGAGATGGAGAAGGG - Intergenic
972411861 4:38802977-38802999 CCATCTTTGCAGATGGACTGAGG + Intronic
972412303 4:38807108-38807130 CCGGGATTGCAGACGGAGTCTGG + Intronic
972464576 4:39342861-39342883 CTGGCTTTGAAGATGCAGGAAGG - Intronic
972551893 4:40141815-40141837 CCGGGATTGCAGATGGAGTCTGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
973218431 4:47697942-47697964 CAAGCCTTGCAGATGGAGGAAGG - Intronic
973372571 4:49263568-49263590 CTGGCTTTGAAGATGCAGTTAGG - Intergenic
973388422 4:49531491-49531513 CTGGCTTTGAAGATGCAGTTAGG + Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973809073 4:54552606-54552628 CTGGCTTTGAAGGTGGAATATGG + Intergenic
974022761 4:56706345-56706367 CAGGCTTTGAAAATGGAGGAAGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
975062533 4:70020172-70020194 CTGGCTTTGAACATGGAGGAAGG - Intergenic
975066711 4:70075554-70075576 GAAGCTTTGCAGTTGGAGTAGGG - Intergenic
975524979 4:75339181-75339203 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
975634973 4:76439188-76439210 CAGACTTTGAAGATGGAGGAAGG - Intronic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976264963 4:83181745-83181767 CCGGGATTGCAGACGGAGTCTGG + Intergenic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976537557 4:86236058-86236080 CTGGCTTTGAAGGTGGAGTAAGG - Intronic
976932595 4:90587084-90587106 CTGGCTTTGCAAATGGATCAAGG + Intronic
976962571 4:90997252-90997274 CTGGCTTTGAAGATGAAGGATGG - Intronic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
978232785 4:106421067-106421089 CTGTCTTTGAAGACGGAGTAAGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978820374 4:112958321-112958343 CCGGGATTGCAGATGGAGTCTGG - Intronic
978842314 4:113229332-113229354 CTGGCTTTGGAGATGGAGAACGG - Intronic
979257986 4:118624344-118624366 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
979330363 4:119416219-119416241 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979641746 4:123016849-123016871 CCGGGATTGCAGACGGAGTCTGG - Intronic
979845849 4:125510637-125510659 CTGACTTTGAAGATGGAGTAAGG - Intergenic
980056637 4:128084351-128084373 CCGGGATTGCAGACGGAGTCTGG - Intronic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980102032 4:128551484-128551506 CTGGCTTTGAAGATGAAGGAGGG - Intergenic
980187472 4:129480029-129480051 TTGGCTTTGAAGATGGAATAAGG - Intergenic
980402089 4:132303851-132303873 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
980726456 4:136767820-136767842 CAGGCTTTGAAGATGGAGGCAGG - Intergenic
980895043 4:138853737-138853759 CCGGGATTGCAGACGGAGTCTGG + Intergenic
981184469 4:141784526-141784548 CTGGCTTTGAAGATGGAGAGAGG + Intergenic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
982040294 4:151390439-151390461 CCGGGATTGCAGACGGAGTCTGG + Intergenic
982182976 4:152765848-152765870 CCGGGATTGCAGACGGAGTCTGG - Intronic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
984005066 4:174295715-174295737 CCGGGATTGCAGACGGAGTCTGG - Intronic
984037770 4:174691660-174691682 CCGGGATTGCAGACGGAGTCTGG + Intronic
984352905 4:178618820-178618842 TTGGCTTTGAAGATGGAGAAAGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985450652 4:190060251-190060273 CCGGCTCTGCAAAGGGACTAGGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986645296 5:9910969-9910991 TGGGCTTTGAAGATGGAGCAAGG - Intergenic
986664646 5:10090193-10090215 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
986788494 5:11138167-11138189 CTGGCTTTGAGGATGGAGAAAGG - Intronic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987214117 5:15714932-15714954 CTGGCTTTGAAGATGGAACAGGG + Intronic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
987469179 5:18309252-18309274 CCGGGATTGCAGACGGAGTCTGG + Intergenic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989108949 5:37888905-37888927 GGAGCTTTGCAGATGGATTAAGG + Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989574928 5:42980101-42980123 CCGGGATTGCAGACGGAGTCTGG + Intergenic
989634742 5:43521769-43521791 CCGGGATTGCAGACGGAGTCTGG + Intergenic
989640574 5:43578876-43578898 CCGGGATTGCAGACGGAGTCTGG - Intergenic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990353410 5:54941043-54941065 CCAGCTTTGAAGATGGAGAAAGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990459212 5:56015700-56015722 CCGGGATTGCAGACGGAGTCTGG - Intergenic
990462134 5:56039323-56039345 CCGGGATTGCAGATGGAGTCTGG - Intergenic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990659884 5:58001549-58001571 CCGGATGTGAACATGGAGTAAGG - Intergenic
990871140 5:60431800-60431822 CTGGGATTGCAGATGGAGTCTGG - Intronic
990916825 5:60915673-60915695 CTAGCTTTGAAGATGGATTAAGG - Intronic
991025182 5:62021521-62021543 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
991148098 5:63331128-63331150 CTGGCTTTGTAGAATGAGTAAGG + Intergenic
991373126 5:65939815-65939837 CCGGGATTGCAGACGGAGTCTGG + Intronic
991723781 5:69516224-69516246 CCGGGATTGCAGACGGAGTCTGG - Intronic
992397847 5:76384099-76384121 CCGGCATTGCAGATGGAGGCAGG - Intergenic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
992801641 5:80300839-80300861 CCGGGATTGCAGACGGAGTCTGG + Intergenic
992964318 5:81984154-81984176 CCGGGATTGCAGACGGAGTCTGG - Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993731555 5:91428837-91428859 CTGGCTTTGAAGATGGAAAAAGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994275916 5:97837109-97837131 CTGGCTTTGGAGATAGAGGAAGG - Intergenic
994605331 5:101960150-101960172 GCTGCTTTGCAGAGGTAGTAAGG + Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
995515854 5:112954478-112954500 CCGGGATTGCAGACGGAGTCTGG + Intergenic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
995895085 5:117002621-117002643 CCGGGATTGCAGACGGAGTCTGG - Intergenic
995942471 5:117600511-117600533 CCGGGATTGCAGACGGAGTCTGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996876521 5:128246415-128246437 CTTGCTTTGAAGATGGAGAAAGG - Intergenic
996960956 5:129249083-129249105 CCGGCTTTGAAGATGTAGGAAGG - Intergenic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
998021983 5:138777585-138777607 CCGGGATTGCAGACGGAGTCTGG - Intronic
998025415 5:138811645-138811667 CCGGGATTGCAGACGGAGTCTGG - Intronic
998313582 5:141158133-141158155 GCGGCTGTGCAGAAGGAGCAGGG + Intergenic
998730074 5:145064742-145064764 CAGGCTTTGAAGAGGGAGGATGG + Intergenic
998806492 5:145922144-145922166 CAGGCTTTGGGGCTGGAGTATGG - Intergenic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999966568 5:156816580-156816602 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
1000159036 5:158582066-158582088 CAGGGATTGCAGATGGAGTCTGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1000755064 5:165147915-165147937 CTGGCTTTGGAGATGGAGAAAGG + Intergenic
1000895159 5:166846470-166846492 CTGGCTTTGAAGATGAAGAAAGG - Intergenic
1000971645 5:167721550-167721572 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001244186 5:170093528-170093550 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001834630 5:174821425-174821447 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1001931302 5:175674983-175675005 TTGGCTTTGCAGGTGGAGAAAGG - Intronic
1002378488 5:178806746-178806768 CTGGCTTTGCAGAATGAGTCAGG - Intergenic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1002529496 5:179835413-179835435 CCGGGATTGCAGACGGAGTCTGG - Intronic
1002581281 5:180210803-180210825 TCAGCTTTGAGGATGGAGTAAGG + Intergenic
1002658351 5:180771536-180771558 CCGGGATTGCAGATGGAGTCTGG - Intergenic
1004415106 6:15416415-15416437 CCGGGATTGCAGACGGAGTCTGG - Intronic
1004664371 6:17736205-17736227 CCGGGTTTGCAGACGGAGTCTGG - Intergenic
1004784532 6:18952395-18952417 TTGGCATTGCAGATCGAGTAGGG - Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1005644832 6:27828203-27828225 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006020216 6:31113336-31113358 TTGGCTTTGGAGATGGAGGAAGG - Intergenic
1006065208 6:31456230-31456252 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1007465249 6:42047298-42047320 TAGCCTGTGCAGATGGAGTATGG + Intronic
1008133424 6:47744223-47744245 CTGACTTTGCAGATGAAGGAAGG - Intergenic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008553868 6:52656647-52656669 CCGGGATTGCAGATGGTGTCTGG - Intergenic
1008841723 6:55910713-55910735 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1008957913 6:57235859-57235881 CTGGCTTTCAAGATGGAGAAGGG + Intergenic
1009372333 6:62921617-62921639 CCAGCTTTGAAGATGAAGGAAGG - Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009887853 6:69645548-69645570 CCTGCTTTGAAGATGTAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010400716 6:75442481-75442503 CCGGGATTGCAGACGGAGTCTGG - Intronic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1012815901 6:104021571-104021593 CTGGCTTTGCAAATGGAGGAAGG + Intergenic
1012833828 6:104240178-104240200 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1012983813 6:105854624-105854646 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1013204447 6:107933989-107934011 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013681428 6:112528894-112528916 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015207512 6:130656699-130656721 CTGGCTTTGCAGTTGCAGCAAGG - Intergenic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1017170286 6:151449917-151449939 CCGGGTTTGCAGACGGAGTCTGG + Intronic
1017465054 6:154686944-154686966 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1017493960 6:154967110-154967132 CCGGGATTGCAGACGGAGTCTGG - Intronic
1017660548 6:156669904-156669926 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1017851643 6:158309618-158309640 CCGGGATTGCAGACGGAGTCTGG - Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018439557 6:163797663-163797685 CCAGCTCTTCAGATGGAGAATGG + Intergenic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019003247 6:168773449-168773471 CCGACTTTGAAGATGGAGGTTGG - Intergenic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1020114960 7:5471078-5471100 CTTGCTTTGCAGATGAAGTCGGG - Intronic
1020146798 7:5650647-5650669 CTGGCTTTGAAGATGGATGAAGG - Intronic
1020285024 7:6672156-6672178 CCAGGATTGCAGATGGAGTCTGG - Intergenic
1020498778 7:8890227-8890249 CCAGGATTGCAGATGGAGTCTGG + Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1022083165 7:27044349-27044371 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1022302044 7:29110919-29110941 CAGGCTTTGAAGCTGGAGGAAGG + Intronic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023381509 7:39612870-39612892 CCGGCTTTGGAGATGGAAGAGGG + Intergenic
1023399975 7:39785634-39785656 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1023703262 7:42912915-42912937 CCCTCTTTGCAGATGGTGTCAGG + Intronic
1023803250 7:43852949-43852971 CTGGCATTGAAGATGGAGTAAGG - Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024072906 7:45801403-45801425 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1024287654 7:47773158-47773180 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1024309728 7:47959090-47959112 CCGGGATTGCAGATGGAGTCTGG + Intronic
1024538580 7:50459225-50459247 CCGGGATTGCAGACGGAGTCTGG + Intronic
1024650430 7:51398775-51398797 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025000466 7:55311484-55311506 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1025054569 7:55754439-55754461 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025132626 7:56384586-56384608 CTGGCTTTGAAGATGGAGTCAGG - Intergenic
1025909834 7:65819508-65819530 CTGACTTTGAAGATGGAGTCAGG + Intergenic
1025911345 7:65831386-65831408 CTGGCTTTGAAGATGGAGTCAGG + Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1025978279 7:66386812-66386834 CTGACTTTGAAAATGGAGTAAGG - Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027374104 7:77534587-77534609 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1027943631 7:84717678-84717700 CTGGCTTTGAAGATGGGGAAGGG + Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028685737 7:93586813-93586835 CCGGGATTGCAGATGGAGTCTGG - Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029569432 7:101360023-101360045 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1030036434 7:105411472-105411494 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030394940 7:108974257-108974279 CTGGCTAAGCAGATGGACTATGG + Intergenic
1030426966 7:109390294-109390316 CTGGCTTTGAAGATAGAGTAAGG - Intergenic
1030465415 7:109895746-109895768 CTAGCTTTGAAGATGGAGAAAGG - Intergenic
1030602630 7:111609578-111609600 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031132072 7:117844116-117844138 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031910412 7:127511160-127511182 CTGGCTTTACACATGGAGAAAGG + Intergenic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032043018 7:128577419-128577441 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1032050289 7:128645104-128645126 TTGGCTTTGAAGATGGAGTCAGG + Intergenic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1032732736 7:134659862-134659884 TTGGCATTGCAGATCGAGTAGGG + Intronic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034233863 7:149553812-149553834 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1034322396 7:150198112-150198134 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1034381630 7:150700955-150700977 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1034923385 7:155101808-155101830 CCGGCTTGGGAGATGGAGGAAGG - Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG + Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037525950 8:19724392-19724414 CTGGCTTTGGAGATGGATTCAGG - Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1039072385 8:33658950-33658972 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1039077429 8:33704423-33704445 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1039153509 8:34529923-34529945 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1039865534 8:41498350-41498372 CCGACTTGGCAGAAGTAGTAGGG - Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041004953 8:53488564-53488586 CCATCTTTGCAGATGGACCAAGG + Intergenic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042195952 8:66231931-66231953 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044000105 8:86868989-86869011 CTGGCTTTGAAGATGGAGGGGGG + Intronic
1044047989 8:87462103-87462125 GAGGCTTTGAAGATGGAGAAAGG + Intronic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1045642913 8:104271639-104271661 CTGGCATTGCAGATTAAGTAGGG - Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1047356323 8:124125548-124125570 CTGGCTTTGAAAATGGAGAAAGG - Intergenic
1047388711 8:124432558-124432580 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1047407180 8:124595483-124595505 CTGGCTTTGAAGATGGACAAAGG - Intronic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1048008649 8:130439169-130439191 CCGGCTTTGGAGGTGGAAGAAGG + Intronic
1048450243 8:134527137-134527159 CTGGCTTTGAAGGTGGAGAAGGG + Intronic
1048489628 8:134880609-134880631 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1048903937 8:139068754-139068776 ACGGCTTTGAAAATGGAGGAAGG - Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049177531 8:141202877-141202899 CCGGGATTGCAGATGGAGTCTGG - Intergenic
1049205081 8:141359845-141359867 GCGGCTTTGCAGCTGGACTGAGG + Intronic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050876056 9:10638041-10638063 CTGGCTTTTATGATGGAGTAAGG + Intergenic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051034040 9:12721601-12721623 CTGGCTTTGGAGATAGAGAAAGG - Intergenic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1051662003 9:19434500-19434522 CCGGGATTGCAGACGGAGTCTGG - Intronic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1052941797 9:34137107-34137129 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053906283 9:42847618-42847640 CTGGCTTTGGAGATGCAGTTAGG + Intergenic
1054675663 9:67854383-67854405 CTGGCTTTGAAGATGCAGTTAGG + Intergenic
1054994799 9:71373763-71373785 CTGGCTTTATAGATTGAGTAAGG - Intronic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055241974 9:74197113-74197135 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055567964 9:77587981-77588003 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1056118143 9:83461247-83461269 CTGGCTTTGAAGATGGAGGCAGG + Intronic
1056152383 9:83803521-83803543 CCGGGATTGCAGACGGAGTGTGG + Intronic
1056485530 9:87053322-87053344 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1056564527 9:87759627-87759649 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1058018732 9:100067459-100067481 CCGGGATTGCAGACGGAGTCTGG + Intronic
1058578570 9:106430325-106430347 CCTGCTTTATAGATGGAGTGAGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1058978851 9:110150439-110150461 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059466120 9:114469909-114469931 CCAGCCTTGAAGATGGAGGATGG - Intronic
1059752663 9:117262876-117262898 TTGGCTTTGCAGATGGAGGAAGG + Intronic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060334694 9:122711057-122711079 CTGGGATTGCAGATGGAGTCTGG + Intergenic
1060349975 9:122851765-122851787 CCGGGATTGCAGACGGAGTCTGG + Intronic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062173974 9:135150794-135150816 TCAGCTTTGAAGATGGAGGAGGG - Intergenic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1062292241 9:135801325-135801347 CTGGTTTTGCAGATGGAGGGAGG - Intergenic
1203552932 Un_KI270743v1:179429-179451 CTGGCTTTGAAGATGCAGTTAGG + Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186206772 X:7208920-7208942 CCAGCCTTGAAGATGGAGGAAGG - Intergenic
1186245269 X:7610052-7610074 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186489345 X:9959436-9959458 CTGGCTTTGCGGATGGAGGAAGG - Intergenic
1186557416 X:10574279-10574301 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1186583005 X:10840984-10841006 CGGGCTTTGAAGATAGAGGAAGG + Intergenic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186621912 X:11250621-11250643 CCGGCTTCAAAGATGGAGAAAGG - Intronic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186786775 X:12962910-12962932 CCGGGTTTGCAGACGGAGTCTGG + Intergenic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1186935719 X:14448783-14448805 CCGTCTTTGCAGATGGACAAGGG + Intergenic
1187111257 X:16302966-16302988 CAGGCTTTGAAGATGGAAGAAGG + Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187333896 X:18365121-18365143 CTGGCTTTGAAGATGGACAAAGG - Intergenic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1187509190 X:19902259-19902281 CCGGCTTTGAAGATGGAAGGTGG + Intergenic
1188299224 X:28487058-28487080 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1188410913 X:29871107-29871129 CCGGTTTTGAAGATGGAAAAAGG - Intronic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188570516 X:31579979-31580001 CTGGCTTTGAAGATAGAGAAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189210088 X:39277157-39277179 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1189505751 X:41611967-41611989 CCGGGATTGCAGATGGAGTCTGG + Intronic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1189968722 X:46396726-46396748 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190166088 X:48073979-48074001 TCAGCTTTGAAGATGGAGGAAGG - Intergenic
1190528591 X:51352553-51352575 CTGGCTTTGAAGATGGAGTTAGG - Intergenic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1190891632 X:54573273-54573295 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1191637246 X:63392703-63392725 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1192341357 X:70266242-70266264 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1192353013 X:70372370-70372392 CCGGGATTGCAGACGGAGTCTGG - Intronic
1192768405 X:74165979-74166001 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1193132533 X:77932632-77932654 CCGGGTTTGCAGACGGAGTCTGG - Intronic
1193362079 X:80590657-80590679 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1193502823 X:82300991-82301013 CTGGCTTTGCAGAATGAGTGTGG - Intergenic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194904701 X:99560147-99560169 CTGGCCTTGCAGAATGAGTAAGG - Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196724487 X:118884109-118884131 CAGGCTTTGAAGACGGAGGAAGG - Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1196969635 X:121094919-121094941 CCGGCCTTGAAGATGGAAAAAGG - Intergenic
1197253568 X:124239416-124239438 CTGGCTTTGAAGATGAAGAAAGG - Intronic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197646338 X:129021711-129021733 CTGGCTTTGAAGGTGGAGAAAGG - Intergenic
1197690946 X:129500741-129500763 CTGGCATTGCAGATCAAGTAGGG - Intronic
1198246743 X:134838962-134838984 CCGGGATTGCAGACGGAGTCTGG + Intronic
1198260321 X:134960007-134960029 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1198377341 X:136052871-136052893 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1198431219 X:136568049-136568071 CTGGCTTTGAAGATGGAGGCCGG - Intergenic
1198476685 X:137001395-137001417 CCGGGATTGCAGACGGAGTCTGG - Intergenic
1198651748 X:138870771-138870793 CTGGCTTTGGAGATGTAGGAAGG + Intronic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199230858 X:145435895-145435917 CCGGGATTGCAGACGGAGTCTGG + Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199802421 X:151264915-151264937 CTGGCTTTGGAGATAGAGGAAGG - Intergenic
1199821033 X:151446604-151446626 CTGGCTTTGATGATGGAGTAAGG + Intergenic
1199941554 X:152632699-152632721 CAGCCTTTCCAGATGGAGAAAGG + Intergenic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1201154197 Y:11115003-11115025 CTGGCTTTGAAGATGCAGTTAGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201578643 Y:15488065-15488087 CCAGCTTTGAAGATGGAGGAAGG - Intergenic
1201747509 Y:17394825-17394847 CTGGCATTGCAGATCAAGTAGGG - Intergenic
1201855422 Y:18535648-18535670 CTGGCATTGCAGATGGTTTAGGG + Intergenic
1201877899 Y:18784737-18784759 CTGGCATTGCAGATGGTTTAGGG - Intronic