ID: 901862449

View in Genome Browser
Species Human (GRCh38)
Location 1:12083357-12083379
Sequence GTTATTATGATAGTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901862449_901862455 16 Left 901862449 1:12083357-12083379 CCCAGCAGCACTATCATAATAAC 0: 1
1: 0
2: 2
3: 7
4: 104
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
901862449_901862456 19 Left 901862449 1:12083357-12083379 CCCAGCAGCACTATCATAATAAC 0: 1
1: 0
2: 2
3: 7
4: 104
Right 901862456 1:12083399-12083421 CGAGAGCAGGCCCGGAGTGGTGG 0: 1
1: 0
2: 1
3: 37
4: 461
901862449_901862454 11 Left 901862449 1:12083357-12083379 CCCAGCAGCACTATCATAATAAC 0: 1
1: 0
2: 2
3: 7
4: 104
Right 901862454 1:12083391-12083413 ATGTCTATCGAGAGCAGGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 64
901862449_901862453 6 Left 901862449 1:12083357-12083379 CCCAGCAGCACTATCATAATAAC 0: 1
1: 0
2: 2
3: 7
4: 104
Right 901862453 1:12083386-12083408 GTGGAATGTCTATCGAGAGCAGG 0: 1
1: 0
2: 1
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901862449 Original CRISPR GTTATTATGATAGTGCTGCT GGG (reversed) Intronic
901862449 1:12083357-12083379 GTTATTATGATAGTGCTGCTGGG - Intronic
908303628 1:62787855-62787877 ATTATTATAATAGTGATACTGGG + Intronic
916826462 1:168446457-168446479 ATTATTATTATAGTGCTTCAAGG + Intergenic
917692214 1:177481199-177481221 GTTATTCTGCTTGTGCTGCCTGG - Intergenic
917911538 1:179652127-179652149 TTCATTAAAATAGTGCTGCTGGG - Exonic
918348800 1:183632888-183632910 GTAGTTATGATAATGCTGCATGG - Intronic
921431906 1:215075884-215075906 GTTATTCTGCTGATGCTGCTAGG - Intronic
921538739 1:216385942-216385964 CTCATTATGATAGTGCTTCTTGG - Intronic
1069431848 10:68343620-68343642 ATTATTGTGGTAGTACTGCTAGG + Exonic
1070225660 10:74502424-74502446 GTGATTGTGAAAGTGCTGCAGGG - Intronic
1072297030 10:94018934-94018956 TTTATTATTATAGTGCTGAAGGG + Intronic
1079383459 11:19958816-19958838 GTTATTATGAGGTTGGTGCTTGG + Intronic
1082317987 11:50753581-50753603 GTTCTTTTGATAGTGCAGTTTGG - Intergenic
1086234580 11:84613139-84613161 GTTGTCCTGATAGTGTTGCTAGG - Intronic
1086793748 11:91073746-91073768 GTTATTATGATAGGGATAATGGG + Intergenic
1087983010 11:104640572-104640594 GTTCTTATGCTAATCCTGCTAGG + Intergenic
1089731115 11:120519596-120519618 GTTATTATCATAGTGCATTTGGG - Intronic
1091815766 12:3436668-3436690 GCTAATATGATTGTGCTGCCTGG + Intronic
1093426664 12:19035680-19035702 CATATTCTGTTAGTGCTGCTTGG - Intergenic
1098724537 12:73946182-73946204 TTTATTCTGATACTGCTGGTAGG + Intergenic
1098922467 12:76315129-76315151 ATGATTATGATTGTGCTGCATGG - Intergenic
1101855524 12:108439695-108439717 GTTTTAATGTTAGTGCTGGTTGG - Intergenic
1102278858 12:111602601-111602623 AGTATTATGAAAATGCTGCTGGG + Intergenic
1102811078 12:115824505-115824527 GTTTTTAAAATACTGCTGCTTGG + Intergenic
1106218102 13:27720921-27720943 GCTATTGTGATAGTGCTGCAAGG - Intergenic
1108855093 13:54783026-54783048 ATTAAAATGATAGTGCTGATAGG - Intergenic
1110873230 13:80477613-80477635 GGTTTTATGATAGTGGTGGTTGG - Intergenic
1113298648 13:108991002-108991024 GTTATTATTATAGTTCTTATAGG - Intronic
1116019955 14:39448279-39448301 GGTAATAAGATAATGCTGCTTGG - Intergenic
1116395888 14:44448374-44448396 GTTTTAATGTTAGTGCTGGTTGG + Intergenic
1120036350 14:79702779-79702801 GTAATTATTATGGTGCTGATAGG + Intronic
1120401876 14:84042517-84042539 TTAATTATAATAGTGCTACTGGG - Intergenic
1120817572 14:88879691-88879713 ATTATTATGACAGTCTTGCTCGG + Intronic
1124468257 15:29960024-29960046 TTTATTTTGATAGCGCTGGTAGG + Intronic
1126132634 15:45357614-45357636 GCTATTATGATAAGGCTGCTGGG - Intergenic
1131710096 15:95044206-95044228 GTTATCATGATATTGCTGAGGGG - Intergenic
1137081605 16:36066624-36066646 TTTATTTTGATAGAGCTGTTTGG + Intergenic
1138645555 16:58421799-58421821 GAAATTATGCAAGTGCTGCTGGG - Intergenic
1140638992 16:76949841-76949863 GTTCTTATGTTATTTCTGCTGGG + Intergenic
1140719389 16:77757638-77757660 GTTTTTATGGAAGTGCTGGTAGG - Intergenic
1140756123 16:78068455-78068477 GTTAAAATGATGGTGCTGCTGGG - Intergenic
1152493347 17:80652924-80652946 ATTATTATGATAGTCCTAGTGGG + Intronic
1155390834 18:25334907-25334929 GTTAATATGACAGTCCTGCAAGG + Intronic
1158241839 18:55386453-55386475 GAAATTATGATTGTGCTCCTTGG - Intronic
1159409043 18:68045787-68045809 GTTATTTTTAAAGTGCTTCTAGG + Intergenic
1164584444 19:29457687-29457709 TTTATTATGGTAATGCTCCTAGG - Intergenic
926110151 2:10177475-10177497 GTTATTATGATATTGCCTTTAGG - Intronic
926671845 2:15583938-15583960 GTTCTCATGATATTGCAGCTGGG - Intergenic
929136745 2:38631783-38631805 GTTGGTATGATACTGCTGATAGG + Intergenic
929861316 2:45680299-45680321 GTTAGTTTGTTAGTGCTGATTGG + Intronic
932836784 2:75045639-75045661 GTTCTTTTGATGGAGCTGCTAGG + Intergenic
934617343 2:95781521-95781543 GTTATTTTAATTGTGATGCTAGG - Intergenic
934643550 2:96043038-96043060 GTTATTTTAATTGTGATGCTAGG + Intergenic
935689110 2:105714462-105714484 GTTATAATGAAAGTACCGCTGGG - Intergenic
936082599 2:109444706-109444728 GTTCTGTTGTTAGTGCTGCTTGG - Intronic
941938606 2:171008978-171009000 ATTATCATGATAGTTCAGCTGGG - Intronic
942532042 2:176921404-176921426 TCTATTGTGATAGTGCTGCAGGG - Intergenic
943236217 2:185323659-185323681 GTTGTTTTTATAGTTCTGCTAGG + Intergenic
944220073 2:197294448-197294470 GTTATTATGAAACTCCTCCTAGG - Intronic
945121086 2:206458050-206458072 ATAAATATGATTGTGCTGCTAGG + Intronic
947317155 2:228873045-228873067 GTGATTATGGTAATGCTGTTAGG - Intronic
947555176 2:231085829-231085851 GTTTTTATCATCGTGGTGCTGGG + Intronic
948680191 2:239628393-239628415 GGTGATATGATAGTGCTGCCTGG - Intergenic
1169356542 20:4911318-4911340 GTTATTATTTTCCTGCTGCTTGG - Intronic
1170958095 20:21000259-21000281 TTTCTTATGAAAGTGCTCCTAGG + Intergenic
1172287479 20:33751068-33751090 GTTAAAATGATGGTACTGCTGGG - Intronic
1181879879 22:25969911-25969933 GTTATTATGATGATGATGATAGG - Intronic
951896807 3:27617242-27617264 GTTATTAAGACAATGCTTCTGGG - Intergenic
958660229 3:97057647-97057669 GTGATTATGATAGTTGTGGTAGG - Intronic
959614170 3:108328743-108328765 GCTACTTTGATAGTGGTGCTGGG + Intronic
960532427 3:118780048-118780070 GCTATTATGATAGTTCTATTAGG + Intergenic
963613149 3:147498087-147498109 GCTTTTATGAGATTGCTGCTTGG + Intronic
965141268 3:164838730-164838752 GTAAATATGAGAGTGCTGCTGGG - Intergenic
966653764 3:182330018-182330040 GTTATTATTATGTTTCTGCTTGG + Intergenic
967745609 3:193051733-193051755 GTTATTAAGAAAGTGCTTCCAGG + Intergenic
974286904 4:59880746-59880768 GTTATTACCATATTGATGCTTGG - Intergenic
974989331 4:69064937-69064959 ATTATTATGATAGTGGTGGCAGG + Intronic
975720911 4:77247834-77247856 GTTTTCAAGATAGTGCTGCTTGG + Intronic
977055463 4:92184882-92184904 CTAATTATGTTAGTGGTGCTTGG - Intergenic
990032577 5:51279748-51279770 TTTATTAAGAAAGTGCTTCTGGG - Intergenic
997810037 5:136958068-136958090 GTTATTAATAAAGTCCTGCTTGG + Intergenic
999811315 5:155130209-155130231 GTTTTTAAAATATTGCTGCTTGG - Intergenic
1000955576 5:167538955-167538977 GTGATTATAATAATGCTGATCGG - Intronic
1005473952 6:26189124-26189146 GCTATTATAAAAGTGCTGCGTGG - Intergenic
1009265550 6:61550471-61550493 GTTATTGTGATAGTGCTGCAAGG + Intergenic
1009961197 6:70523825-70523847 CTTCTTATGAGAGAGCTGCTTGG - Intronic
1010567593 6:77435412-77435434 GTCATTATGATAGTGATATTTGG - Intergenic
1013267335 6:108512614-108512636 GTTATTTTGATATTTCAGCTAGG + Intronic
1014374569 6:120657089-120657111 GATATTATGATAATGCTACAAGG - Intergenic
1015424167 6:133046148-133046170 TCAATTATAATAGTGCTGCTGGG + Intergenic
1016380041 6:143468362-143468384 GTTATTATGATGATGATGGTAGG + Intronic
1017646644 6:156545342-156545364 GTTATCATTATAGTCCTACTGGG + Intergenic
1027685247 7:81272384-81272406 CTTGATAGGATAGTGCTGCTTGG + Intergenic
1030565886 7:111155063-111155085 GTTATTATTAAAATTCTGCTGGG + Intronic
1035187957 7:157140311-157140333 GTTATTAAGATTGTGCTGTGGGG + Intronic
1038979076 8:32737040-32737062 GTTTTTATTATACTGGTGCTGGG + Intronic
1041705828 8:60845228-60845250 ATTATTATGATGGTGATTCTAGG + Exonic
1045160541 8:99537879-99537901 TTAATTATGATAATGCTGCTAGG - Intronic
1047006127 8:120622186-120622208 GTAATTCTGAGAGTCCTGCTTGG + Intronic
1050876331 9:10641318-10641340 GTTGTTATAATATTGCTGTTAGG - Intergenic
1054337885 9:63824025-63824047 GTGATTTCGAAAGTGCTGCTTGG - Intergenic
1055550450 9:77427944-77427966 GTTTTAGAGATAGTGCTGCTCGG + Intronic
1056080086 9:83083495-83083517 CATATGATGATAGTGATGCTTGG - Intergenic
1061096673 9:128461229-128461251 GTTCTTATGATACTGCTGTGTGG + Intronic
1203353117 Un_KI270442v1:98963-98985 GTTCTTCTGATAGTGCAGTTTGG + Intergenic
1203400120 Un_KI270519v1:80657-80679 TTTATTTTGATTGTGCAGCTTGG + Intergenic
1188589471 X:31816050-31816072 GTTATTCTGATGGTCTTGCTTGG - Intronic
1189031430 X:37455371-37455393 GTTATTATTATTGTGCTTCATGG + Exonic
1189226915 X:39420660-39420682 GTTATTGTGGAAGTGGTGCTGGG - Intergenic
1189834864 X:45009316-45009338 GACGTTGTGATAGTGCTGCTAGG + Intronic
1190754222 X:53387362-53387384 GTTATTATGTTAGTGTTGCTAGG + Intronic
1193150550 X:78119664-78119686 GTTCTTGTGATAGTGTTGTTTGG + Intronic
1198036028 X:132802303-132802325 GTTATTATCCTTGTGCTGCCCGG - Intronic
1198850237 X:140958894-140958916 GTCATTTTTATAGTGCAGCTTGG - Intergenic