ID: 901862450

View in Genome Browser
Species Human (GRCh38)
Location 1:12083358-12083380
Sequence GGTTATTATGATAGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901862450_901862456 18 Left 901862450 1:12083358-12083380 CCAGCAGCACTATCATAATAACC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 901862456 1:12083399-12083421 CGAGAGCAGGCCCGGAGTGGTGG 0: 1
1: 0
2: 1
3: 37
4: 461
901862450_901862455 15 Left 901862450 1:12083358-12083380 CCAGCAGCACTATCATAATAACC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
901862450_901862453 5 Left 901862450 1:12083358-12083380 CCAGCAGCACTATCATAATAACC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 901862453 1:12083386-12083408 GTGGAATGTCTATCGAGAGCAGG 0: 1
1: 0
2: 1
3: 2
4: 57
901862450_901862454 10 Left 901862450 1:12083358-12083380 CCAGCAGCACTATCATAATAACC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 901862454 1:12083391-12083413 ATGTCTATCGAGAGCAGGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901862450 Original CRISPR GGTTATTATGATAGTGCTGC TGG (reversed) Intronic
900741792 1:4334629-4334651 AGTAATTATGTTTGTGCTGCTGG - Intergenic
900945582 1:5829667-5829689 GGTGATGATGATAGTGATGGTGG + Intergenic
900945585 1:5829691-5829713 GGTGATGATGATAGTGATGGTGG + Intergenic
901862450 1:12083358-12083380 GGTTATTATGATAGTGCTGCTGG - Intronic
903671125 1:25036012-25036034 GGTGATGATGGTAGTGTTGCTGG - Intergenic
906514887 1:46433031-46433053 GGTCATTATGAAAGTGCTCAAGG + Intergenic
907176242 1:52525589-52525611 GATTCTGATGATAGTGCTTCAGG - Exonic
910169012 1:84358237-84358259 GGTTCTTATGACAGTGGTGAAGG - Intronic
915024435 1:152814001-152814023 TATTATTATTATAGTGTTGCTGG + Intergenic
915269857 1:154746326-154746348 GGTTGGGATGACAGTGCTGCGGG + Intronic
1066973399 10:42340015-42340037 TGGTATTATGATAATGCTACAGG - Intergenic
1068856580 10:61804029-61804051 GGTGATGATGATAGTGATGATGG + Intergenic
1070225661 10:74502425-74502447 TGTGATTGTGAAAGTGCTGCAGG - Intronic
1072297029 10:94018933-94018955 CTTTATTATTATAGTGCTGAAGG + Intronic
1074141465 10:110677201-110677223 GGTTATTATGAGAGTGGGACTGG - Intronic
1075922812 10:126227085-126227107 GGTGATAATGATAGTGATGGTGG - Intronic
1077417094 11:2429271-2429293 GGTGATGATGATAGTGGTGGTGG + Intergenic
1079688891 11:23398014-23398036 GGTTCTTATGAAGGTGCTGTGGG - Intergenic
1088580573 11:111311576-111311598 AGCTATTATTATTGTGCTGCTGG - Intergenic
1089731116 11:120519597-120519619 GGTTATTATCATAGTGCATTTGG - Intronic
1092047449 12:5442138-5442160 GGTTACAATCATAGTGCTCCAGG + Intronic
1099171136 12:79365928-79365950 TGTTATCATAATAATGCTGCTGG - Intronic
1100894405 12:99163565-99163587 GATTCTTATGATGGTGCTGTCGG - Intronic
1101330569 12:103754568-103754590 GGTGATTATGATAATGGTGGTGG + Intronic
1102014016 12:109636072-109636094 GGTGATGATGATGGTGGTGCTGG - Intergenic
1102278857 12:111602600-111602622 GAGTATTATGAAAATGCTGCTGG + Intergenic
1103199493 12:119075460-119075482 GGTGATGATGATGGTGCTGATGG + Intronic
1103199552 12:119076033-119076055 GGTGATGATGATAGTGATGATGG + Intronic
1104421408 12:128638799-128638821 GGTGATTATGATGGTGCTGATGG + Intronic
1104613312 12:130247947-130247969 GGTGATGATGATAGTGATGATGG + Intergenic
1104762198 12:131304189-131304211 GGTGATGATGATAGTGATGATGG - Intergenic
1104817578 12:131656607-131656629 GGTGATGATGATAGTGATGATGG + Intergenic
1107136906 13:36954858-36954880 GTTAATTTTGATAGGGCTGCAGG - Intronic
1109888394 13:68574363-68574385 GCTTATTATGATAGTGCTTTGGG + Intergenic
1115465632 14:33711567-33711589 CTGTTTTATGATAGTGCTGCAGG + Intronic
1119566200 14:75631287-75631309 GGTGATTCTGATCGTGCTCCAGG - Intronic
1120026698 14:79593868-79593890 GGTGATTGGGATAGCGCTGCTGG + Intronic
1120574838 14:86169261-86169283 GGATATTAGGCTAGTTCTGCTGG - Intergenic
1125893066 15:43280243-43280265 GATGATGATGATAGTGATGCTGG - Intronic
1126132635 15:45357615-45357637 GGCTATTATGATAAGGCTGCTGG - Intergenic
1127172788 15:56321028-56321050 GGTTTTTATGCTACAGCTGCAGG + Intronic
1129163938 15:73764686-73764708 GGTGATGATGATGGTGCTGGTGG + Intergenic
1131710097 15:95044207-95044229 AGTTATCATGATATTGCTGAGGG - Intergenic
1133717017 16:8459538-8459560 GGTCATTGTGGTTGTGCTGCTGG - Intergenic
1136002541 16:27305986-27306008 GGTGATGATGATAGTGATGGTGG - Intergenic
1138645556 16:58421800-58421822 GGAAATTATGCAAGTGCTGCTGG - Intergenic
1140756124 16:78068456-78068478 TGTTAAAATGATGGTGCTGCTGG - Intergenic
1141676284 16:85519257-85519279 GGTGATGATGATAGTGATGGTGG - Intergenic
1141676296 16:85519339-85519361 GGTGATGATGATAGTGATGGTGG - Intergenic
1141676305 16:85519409-85519431 GGTGATGATGATAGTGATGGTGG - Intergenic
1141676314 16:85519479-85519501 GGTGATGATGATAGTGATGGTGG - Intergenic
1141676323 16:85519549-85519571 GGTGATGATGATAGTGATGGTGG - Intergenic
1141817137 16:86419266-86419288 GGTGATGATGATGGTGGTGCTGG + Intergenic
1141817206 16:86419683-86419705 GGTGATGATGATGGTGCTGATGG + Intergenic
1141843148 16:86587612-86587634 GGTGATGATGATAGTGATGACGG - Intergenic
1141931861 16:87210503-87210525 GGTGATGATGATGGTGCTGATGG + Intronic
1141988728 16:87597353-87597375 GGTAATGATGATAGTGATGATGG - Intergenic
1142503052 17:344512-344534 GGTGATGATGATAGTGATGATGG - Intronic
1143315111 17:6026560-6026582 GGTTTTTATCAAAGTTCTGCAGG + Intronic
1146102972 17:30003885-30003907 GGTTATAATGCTATTGATGCAGG + Intronic
1146387090 17:32386804-32386826 GGCTATTGTGATCGAGCTGCAGG + Intergenic
1147631043 17:41931839-41931861 GGTTACTATAATAATGTTGCTGG - Intronic
1150239429 17:63620461-63620483 GGTTATTATGCTAATACTGTGGG - Intergenic
1150487966 17:65557098-65557120 GATTATTTTGTTAGTGCTGATGG - Intronic
1151432890 17:74076555-74076577 GGTGGTGATGATAGTGCTGGTGG + Intergenic
1152311771 17:79555732-79555754 GGTGATTATGATAGTAGTGGTGG + Intergenic
1152658631 17:81531698-81531720 GGTGATGATGATAGTGATGGTGG + Intronic
1157296283 18:46447617-46447639 GGTAATGCTGATAGTGCTGAGGG - Exonic
1157980328 18:52372381-52372403 GGTTATGAGGACAGTGCTGTAGG + Intronic
1159141330 18:64398898-64398920 GGTAATTCTCATAGTGCTCCAGG - Intergenic
1161929854 19:7331806-7331828 GATGATTATGATAGTGATGATGG - Intergenic
1164721487 19:30435023-30435045 GGTGATGATGATGGTGCTGGTGG + Intronic
1164721496 19:30435142-30435164 GGTGATTATGATGGTGATGGTGG + Intronic
1166417319 19:42605485-42605507 GGTAATGATTATAGGGCTGCAGG + Intronic
931170867 2:59802510-59802532 GGTTTCTATGTTAGTGCTGGTGG - Intergenic
932630100 2:73334057-73334079 GGTTATTCTGAAAGTTGTGCAGG - Intergenic
938312846 2:130304887-130304909 GGTAATTATGATGGTGATGATGG + Intergenic
940290592 2:152074411-152074433 GGTTATGGTGGTGGTGCTGCTGG - Intronic
941703792 2:168635574-168635596 AGTTATTGAGATACTGCTGCCGG - Intronic
941938607 2:171008979-171009001 GATTATCATGATAGTTCAGCTGG - Intronic
942532043 2:176921405-176921427 GTCTATTGTGATAGTGCTGCAGG - Intergenic
945701843 2:213180088-213180110 GGTGAATATCATAGAGCTGCTGG + Intergenic
947555175 2:231085828-231085850 GGTTTTTATCATCGTGGTGCTGG + Intronic
948183210 2:235999328-235999350 GGTGATGATGATAGTGGTGATGG + Intronic
948518406 2:238520649-238520671 GGTTGTGATGATAGTGATGATGG + Intergenic
948518424 2:238520790-238520812 GGTTGTGATGATAGTGATGATGG + Intergenic
1170797752 20:19564371-19564393 GGTGATGATGATAGTGATGATGG - Intronic
1171118189 20:22545231-22545253 GGTGATTATGATAGTGATAATGG - Intergenic
1171878883 20:30602060-30602082 GGTGATGATGATAGTGATGATGG - Intergenic
1174086429 20:48011509-48011531 TTTTATTATGAAAATGCTGCAGG + Intergenic
1180437804 22:15329544-15329566 TGGTATTATGATAATGCTACAGG - Intergenic
1182612796 22:31563291-31563313 GGTGATTATGATAATGATGCAGG - Intronic
1183092660 22:35533519-35533541 GGTAATAATGATAGTGATGATGG + Intergenic
1184519731 22:44986263-44986285 GGTGCTCATGATGGTGCTGCTGG - Intronic
1184666883 22:45993987-45994009 GGTGGTTATGATAGTGATGGAGG + Intergenic
1185200529 22:49501076-49501098 GGTGATGATGATAGTGATGATGG - Intronic
953279049 3:41534325-41534347 CATTATTCTGACAGTGCTGCTGG + Intronic
960923798 3:122776671-122776693 GATTTTTATGTTATTGCTGCTGG + Intronic
961534858 3:127564092-127564114 GGTGGTGATGATGGTGCTGCTGG - Intergenic
961656605 3:128445860-128445882 GGTGATGATGATAGTGGTGGTGG + Intergenic
961656619 3:128445926-128445948 GGTGGTAATGATAGTGGTGCTGG + Intergenic
965141269 3:164838731-164838753 TGTAAATATGAGAGTGCTGCTGG - Intergenic
966129018 3:176615168-176615190 GGTTGTGATGATAGTGAGGCTGG + Intergenic
966302044 3:178489955-178489977 GCTTATGATGATGGTGCTGGAGG - Intronic
967117516 3:186355270-186355292 GGTGATGATGATCGTGCTGGTGG - Intronic
969503075 4:7566024-7566046 GGTGATAATGATAGTGATGATGG + Intronic
969710890 4:8842737-8842759 GGTGATTATGATGGTGATGATGG + Intergenic
971925760 4:33007496-33007518 TGTTATCATGATAGTGTGGCTGG - Intergenic
972404631 4:38734136-38734158 GGTGATGATGGTAGTGCTGGTGG + Intergenic
975049506 4:69842749-69842771 GGTAATTATAATAGTCCAGCAGG + Intronic
975824089 4:78301614-78301636 GCTGATTCTGATGGTGCTGCAGG + Intronic
977120819 4:93098817-93098839 GTTTATTATGATAATGATGCAGG + Intronic
981548752 4:145921001-145921023 AGTTATTATGATAGAGCTATGGG + Intronic
982498666 4:156126069-156126091 GGTTACTTTGATAGTGGTGATGG + Intergenic
983093265 4:163531716-163531738 GGTGATTATGACAATGTTGCAGG + Intronic
983097094 4:163575537-163575559 GGTTGTTATCAGAGTGATGCTGG + Intronic
983121222 4:163887467-163887489 GATAATTATGCTGGTGCTGCTGG - Intronic
984619758 4:181939234-181939256 GGTTATAATCCTAGTCCTGCAGG + Intergenic
985232985 4:187841771-187841793 GGTCATTATGTCAATGCTGCTGG - Intergenic
992998755 5:82358458-82358480 GGTTATTTTGATAGTTGTGCAGG + Intronic
994078953 5:95684659-95684681 GGTCATAATGTAAGTGCTGCAGG - Intronic
995924073 5:117348115-117348137 GGTACGTATGATAGTGCTCCAGG - Intergenic
1000724851 5:164757184-164757206 GGATATTAGGTTAGTGCTACAGG - Intergenic
1001298729 5:170518056-170518078 GGTCATAATGATAGTGATGGTGG + Intronic
1002054779 5:176592505-176592527 GATTATGATGATAGTGGTGGTGG + Intronic
1003561115 6:7181509-7181531 GGTTCTTAGGAGGGTGCTGCAGG + Intronic
1004570609 6:16841030-16841052 GGTGATTGTGATGATGCTGCCGG - Intergenic
1006482690 6:34310550-34310572 GGTTATTATGGTGGTGGTGGTGG - Intronic
1019310072 7:355923-355945 GGTGATGATGATAGTGATGGTGG - Intergenic
1024644865 7:51362622-51362644 GGTGATGATGATAGTGGTGGTGG - Intergenic
1027922651 7:84415086-84415108 GGATATTAAGATAGTATTGCTGG + Intronic
1030471305 7:109965683-109965705 GGTTATCATGAGAGTGTTGTGGG - Intergenic
1035107043 7:156449713-156449735 GGTGATGATGATAGTGGTGGTGG + Intergenic
1035187956 7:157140310-157140332 TGTTATTAAGATTGTGCTGTGGG + Intronic
1035323345 7:158048802-158048824 GGTGATGATGATAGTGATGGTGG - Intronic
1035405467 7:158594262-158594284 GGTTATTATGGTGCTGCTGAAGG + Intergenic
1038236239 8:25759456-25759478 AGTTATTAAGAAATTGCTGCAGG - Intergenic
1043226244 8:77734802-77734824 GGTGGTTAGGATAGTGCTACTGG - Intergenic
1048180211 8:132187650-132187672 GGTTGTGATGATAGTGGTGGTGG + Intronic
1048180217 8:132187689-132187711 GGTTGTGATGATAGTGGTGGTGG + Intronic
1049228395 8:141469091-141469113 GGTGATAATGATGGTGGTGCAGG + Intergenic
1049580974 8:143410801-143410823 GGTAATGGTGATAGTGGTGCTGG + Intergenic
1049908399 9:241656-241678 GGCTATTGTGAAAATGCTGCAGG + Intronic
1050940591 9:11452374-11452396 GGTCAAAATGAAAGTGCTGCAGG - Intergenic
1052273724 9:26655162-26655184 GCTTATTAAGAAAGTGCTGTGGG + Intergenic
1053108532 9:35436197-35436219 TGTTATTAGGATATTGCTTCTGG + Intergenic
1055801585 9:80042424-80042446 GCTTATTATGAGAGTGCTTTGGG + Intergenic
1056717003 9:89039977-89039999 GGTGATGGTGATAGTGCTGATGG - Intronic
1186131679 X:6473395-6473417 GGTAATGATGATAGTGATGGTGG + Intergenic
1186655543 X:11608452-11608474 GGTTATGATGGTAGTGATGATGG - Intronic
1188566992 X:31537823-31537845 TATTACTATGATAGTGCTACGGG - Intronic
1190167144 X:48082713-48082735 GGTTATGAAGGTATTGCTGCAGG - Intergenic
1196289334 X:113920491-113920513 GGTTATTATGAGAGTTCAGTGGG + Intergenic
1197455081 X:126669604-126669626 ATTTATTATTATAGTGCTTCAGG - Intergenic
1198448574 X:136743130-136743152 GATAATAATGATAGGGCTGCAGG - Intronic
1200860418 Y:7985837-7985859 GGTTATTATGATGGTTCTAATGG - Intergenic
1201143521 Y:11048032-11048054 TGGTATTATGATAGTGATGATGG + Intergenic
1201143598 Y:11048725-11048747 TGGTATTATGATAGTGATGATGG + Intergenic