ID: 901862452

View in Genome Browser
Species Human (GRCh38)
Location 1:12083379-12083401
Sequence TCGATAGACATTCCACTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901862452_901862459 24 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862459 1:12083426-12083448 TACCTGTAATCCCAGCACTTTGG 0: 4761
1: 166787
2: 306278
3: 212252
4: 197042
901862452_901862460 25 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862460 1:12083427-12083449 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
901862452_901862462 28 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862462 1:12083430-12083452 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
901862452_901862456 -3 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862456 1:12083399-12083421 CGAGAGCAGGCCCGGAGTGGTGG 0: 1
1: 0
2: 1
3: 37
4: 461
901862452_901862455 -6 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901862452 Original CRISPR TCGATAGACATTCCACTTTT TGG (reversed) Intronic
901862452 1:12083379-12083401 TCGATAGACATTCCACTTTTTGG - Intronic
903397825 1:23015478-23015500 GCTATAGTAATTCCACTTTTGGG + Intronic
906109666 1:43314237-43314259 ACAATGGACATTCCAGTTTTGGG + Intronic
908379703 1:63584852-63584874 TGGATAGATTTTCCACTTGTGGG + Intronic
911785796 1:101945139-101945161 TAGATAGCCATTTCACTTCTAGG + Intronic
919409310 1:197224228-197224250 TTGATATACATTATACTTTTTGG - Intergenic
921941820 1:220848845-220848867 TGGAAAGACATTCCAGTTTATGG - Intergenic
1066594232 10:37031560-37031582 TGAAGAGACTTTCCACTTTTTGG + Intergenic
1068020527 10:51577478-51577500 TCGATAGGAATACCACATTTAGG - Intronic
1070304135 10:75228192-75228214 TGGATAGACATTCCTATTATTGG - Intronic
1079986580 11:27206481-27206503 TTTCTAGAAATTCCACTTTTGGG - Intergenic
1086810678 11:91306471-91306493 TTGATAGACATTACAATTCTTGG - Intergenic
1090435061 11:126679846-126679868 TTCATACACATTTCACTTTTTGG - Intronic
1091797797 12:3307148-3307170 TCAATAGACATTTCAGTTTCTGG - Intergenic
1093307367 12:17537666-17537688 TGGATTGGCATTCTACTTTTGGG - Intergenic
1094796773 12:33983025-33983047 TGGATATACATTCTAATTTTGGG - Intergenic
1111709382 13:91792660-91792682 TCAATAGCTATTCCACTGTTAGG + Intronic
1112758072 13:102662004-102662026 CTGATGGACATTCCACCTTTTGG - Intronic
1114317889 14:21524507-21524529 TCCACAGACATTGCACTTATAGG + Exonic
1115547185 14:34474751-34474773 TCATTAGAAATTCCTCTTTTAGG + Intergenic
1116707753 14:48324780-48324802 TGGATAGACTTTCCACATTGAGG + Intergenic
1118260001 14:64237625-64237647 TTAGTGGACATTCCACTTTTAGG - Intronic
1119974508 14:79010527-79010549 TCGATATACCCTCCTCTTTTGGG - Intronic
1125046271 15:35245017-35245039 ACGAAAGTCATTACACTTTTAGG + Intronic
1128034227 15:64509209-64509231 TAGATATTCATTCCAATTTTAGG - Intronic
1133590197 16:7234990-7235012 TCGTTAGACATTCCGTTTTTTGG - Intronic
1137518010 16:49166673-49166695 TACACAAACATTCCACTTTTAGG + Intergenic
1140674236 16:77311473-77311495 TCAATATACAGTCCACTTTTGGG + Intronic
1142700881 17:1659864-1659886 CCGGGAGACATTCCACTTATAGG + Exonic
1143297533 17:5882729-5882751 AAGATATACATTCTACTTTTTGG - Intronic
1149177662 17:53893429-53893451 ATGATAGACATTTCACTGTTTGG - Intergenic
1154973665 18:21436056-21436078 TCAATAGACATTCATCTTTCTGG + Intronic
1155179867 18:23335116-23335138 TTTATACAAATTCCACTTTTGGG + Intronic
1155539134 18:26848908-26848930 ACAATATACCTTCCACTTTTTGG - Intergenic
1156050558 18:32928463-32928485 GATACAGACATTCCACTTTTAGG + Intergenic
1156188974 18:34696715-34696737 GAGATAGACATTTCACTGTTTGG + Intronic
1158873798 18:61713571-61713593 TGGATTGGCATTCTACTTTTGGG + Intergenic
1159783035 18:72681370-72681392 TTGATAGACTTTCTTCTTTTAGG - Intergenic
1165641597 19:37393294-37393316 TAGATAGATATTTCTCTTTTAGG - Intergenic
1166526166 19:43511332-43511354 TGGATGGACATTAGACTTTTAGG - Intronic
932064741 2:68542786-68542808 TATATAGAAATTCCACTTCTGGG + Intronic
935876139 2:107510354-107510376 TCTATAGCCATTGCCCTTTTGGG - Intergenic
944536521 2:200715850-200715872 TAGACAGAAATTCCACTTTTAGG - Intergenic
1170448370 20:16455052-16455074 ACGACAGACATTCTGCTTTTTGG - Intronic
1170659380 20:18321938-18321960 TCCAAAAACCTTCCACTTTTTGG - Intergenic
1176031042 20:63011834-63011856 TGGATTGGCATTCTACTTTTAGG + Intergenic
1179014366 21:37582716-37582738 TCTATAGACATTGCATTTATTGG + Intergenic
950591790 3:13941270-13941292 TGGATTGGCATTCTACTTTTGGG - Intronic
951173714 3:19574639-19574661 TGGATAGACATACCCCTTTGGGG + Intergenic
956645537 3:71452142-71452164 TGGATATACATTCACCTTTTGGG - Intronic
958663334 3:97101684-97101706 TAAATAGACATTTTACTTTTTGG + Intronic
961957155 3:130815878-130815900 TTGATGGAGTTTCCACTTTTTGG - Intergenic
962829998 3:139131434-139131456 TGGAAAGTCATTTCACTTTTTGG + Intronic
967581029 3:191154783-191154805 ATGATACACATTCCTCTTTTTGG + Intergenic
979071734 4:116216255-116216277 TCAATATACATTACTCTTTTGGG + Intergenic
984096835 4:175445216-175445238 TGGATTGGCATTCTACTTTTGGG - Intergenic
991238700 5:64430823-64430845 TGGATAGAAATTTCACGTTTTGG - Intergenic
992286810 5:75244016-75244038 GAGATAGCCTTTCCACTTTTAGG + Intergenic
994635386 5:102339755-102339777 TAGATTAACATTCTACTTTTGGG - Intergenic
999375258 5:151081934-151081956 AGGTTAGACCTTCCACTTTTTGG - Intronic
1008424093 6:51336522-51336544 TTGAAAGACATTCAACTCTTTGG + Intergenic
1010304800 6:74306891-74306913 TCTACAGCCATTCCTCTTTTAGG - Intergenic
1011605271 6:89098050-89098072 TCTATATATATTCTACTTTTTGG + Exonic
1015445857 6:133304055-133304077 TGGATAGATATTCCACTTGAAGG + Intronic
1020403965 7:7810333-7810355 TTGACAGTAATTCCACTTTTAGG + Intronic
1021676164 7:23082804-23082826 TAGATGGGCATTCTACTTTTGGG - Intergenic
1022867864 7:34441236-34441258 TAGATATATATTCCAGTTTTTGG - Intergenic
1024144331 7:46497000-46497022 TTGATAGACATTTAACTTTTTGG - Intergenic
1024156668 7:46632909-46632931 ACAATAGATATTCCACTTTTGGG + Intergenic
1028651377 7:93153613-93153635 TAGATTGACAATCTACTTTTGGG + Intergenic
1033915270 7:146316412-146316434 CCGACAGACATTTCACTGTTTGG + Intronic
1037509514 8:19567513-19567535 ACCATAGACATTACACTTATTGG + Intronic
1038770249 8:30472035-30472057 TATATAGGCATTCCACTTCTAGG + Intronic
1039115843 8:34090438-34090460 TGGATTGACATTTTACTTTTAGG + Intergenic
1041371438 8:57164683-57164705 TCAATAAACATCTCACTTTTTGG - Intergenic
1041610529 8:59841986-59842008 TATCTAGAAATTCCACTTTTAGG - Intergenic
1044095147 8:88054500-88054522 TTGAGAGTCATTACACTTTTTGG + Intronic
1047853045 8:128879622-128879644 ACGGTAGTCATTCCTCTTTTAGG + Intergenic
1056881127 9:90394913-90394935 TCGTTACACTTTCCACCTTTTGG - Intergenic
1186248224 X:7637569-7637591 TTAATAGACTTTACACTTTTAGG + Intergenic
1187089810 X:16084109-16084131 TTGATAGACATTTGAGTTTTGGG + Intergenic
1193120618 X:77819453-77819475 TGGATTGGCATTCTACTTTTGGG - Intergenic
1196493185 X:116292211-116292233 TGGATTGGCATTCTACTTTTGGG + Intergenic
1196894715 X:120323620-120323642 TTCATAGATATTCCACTCTTAGG + Intergenic
1197333666 X:125184928-125184950 TCTATAGTCAGTCCACTGTTAGG - Intergenic
1201518282 Y:14842251-14842273 TTTAAATACATTCCACTTTTAGG - Exonic
1201922291 Y:19246309-19246331 ACAATAGGCATTCCAGTTTTTGG - Intergenic