ID: 901862455

View in Genome Browser
Species Human (GRCh38)
Location 1:12083396-12083418
Sequence TATCGAGAGCAGGCCCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901862449_901862455 16 Left 901862449 1:12083357-12083379 CCCAGCAGCACTATCATAATAAC 0: 1
1: 0
2: 2
3: 7
4: 104
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
901862452_901862455 -6 Left 901862452 1:12083379-12083401 CCAAAAAGTGGAATGTCTATCGA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81
901862450_901862455 15 Left 901862450 1:12083358-12083380 CCAGCAGCACTATCATAATAACC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901862455 Original CRISPR TATCGAGAGCAGGCCCGGAG TGG Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902404584 1:16175697-16175719 TCTCCAGAGCAGGAACGGAGGGG + Intergenic
902561378 1:17279728-17279750 TACCATGAGCAGGCCCCGAGGGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
912567884 1:110601481-110601503 TGTAGAGAGGAGGCCCGGGGTGG + Intronic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915940209 1:160114145-160114167 TCTCAACTGCAGGCCCGGAGGGG + Intergenic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
918371828 1:183868823-183868845 TATCCAGAGCTGGCCGGGCGTGG + Intronic
924156484 1:241181980-241182002 GATAGAGAGCAGGCCAGGAATGG - Intronic
1067072406 10:43143604-43143626 TTTTGAGAGGAGGCCCTGAGAGG + Intronic
1071359062 10:84827623-84827645 TTTCAAGTGCAGGCCCTGAGGGG + Intergenic
1073372862 10:103006494-103006516 AATCTAAAGCAGGCCAGGAGTGG - Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1078443021 11:11383165-11383187 TGCCCTGAGCAGGCCCGGAGAGG - Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1082875529 11:57984544-57984566 TATCCAGAGCAGGCTGGAAGAGG + Intergenic
1085389188 11:76173660-76173682 GAGACAGAGCAGGCCCGGAGGGG + Intergenic
1089200144 11:116719803-116719825 TATTGCGAGCAGGCCCGATGGGG - Intergenic
1089671030 11:120057127-120057149 AATGGAGAGCAGGGACGGAGAGG - Intergenic
1094026409 12:25964011-25964033 TGTTGAGAGCAAGCCCTGAGAGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1101740415 12:107495620-107495642 CATGGAGGGCAGGCCCTGAGAGG - Intronic
1104891459 12:132142176-132142198 TCTCGAAAGCAGGGCCTGAGGGG + Exonic
1105495170 13:20924165-20924187 TGTAGAGACCAGGCCGGGAGCGG + Intergenic
1122149722 14:99718370-99718392 AGTCGGGAGCAGGCTCGGAGGGG - Intronic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1126134656 15:45378519-45378541 TCCCGAGAGCGCGCCCGGAGCGG + Exonic
1131924415 15:97366180-97366202 TATCGTCAGCAGGCTCTGAGGGG - Intergenic
1134911088 16:18026963-18026985 TAACCAGAGTAGGCCGGGAGCGG - Intergenic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1152097825 17:78282162-78282184 TATCGAGATCAGGCCGGGCACGG + Intergenic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1165901929 19:39173250-39173272 TGCCGACATCAGGCCCGGAGAGG - Exonic
1168315801 19:55484303-55484325 GATGGAGGGCAGGCCCTGAGGGG - Exonic
931378783 2:61732641-61732663 TATCTAGAACAGGCCGGGCGCGG - Intergenic
932412501 2:71555603-71555625 GAACCAGAGCAGGCTCGGAGAGG + Intronic
933348026 2:81115155-81115177 TATCAAGTGCAGGCCCGGCATGG + Intergenic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
946930299 2:224663948-224663970 TATTCAGAGCAGGCCCACAGAGG - Intergenic
1169344224 20:4817638-4817660 TCTCCAGAGGAGGCCTGGAGAGG - Intronic
1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG + Intronic
1173736540 20:45365635-45365657 CATGGAGAGCCGGCCTGGAGGGG - Exonic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175264267 20:57693068-57693090 TGTTGTGAGCAGGCCGGGAGTGG + Intronic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
953885686 3:46713260-46713282 AAGCGAGAGCAGGCCCGGCAAGG - Intronic
959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG + Intergenic
960076478 3:113491328-113491350 TATCTATAGCAGGCCGGGCGTGG + Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968426288 4:525788-525810 TTTCCAGAGAAGCCCCGGAGAGG + Intronic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969842082 4:9890097-9890119 TTTAGAGATGAGGCCCGGAGAGG + Intronic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
995873865 5:116770045-116770067 TAATGAGAGTAGGCCAGGAGCGG + Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997013190 5:129903865-129903887 TAGAGAGAGAAGGCGCGGAGTGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1004953640 6:20702624-20702646 TATCGAGAGGACGTCCAGAGGGG - Intronic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1030185799 7:106760475-106760497 CATGGAGAGCAGGCCCGAAAAGG - Intergenic
1034414755 7:150958534-150958556 GATCGCGAGCAGCCCCGGAGCGG + Intronic
1037578094 8:20226705-20226727 TATCCAGAACAGGCCGGGCGCGG - Intronic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1058554747 9:106155026-106155048 CATAGAGAGCAGGCCAAGAGAGG - Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1190866401 X:54388480-54388502 TACCTAAAGCAGGCCAGGAGTGG + Intergenic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic