ID: 901863406

View in Genome Browser
Species Human (GRCh38)
Location 1:12088897-12088919
Sequence GCTGAAGCCCAGGATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 477}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901863406_901863410 -10 Left 901863406 1:12088897-12088919 CCCTCTTCATCCTGGGCTTCAGC 0: 1
1: 0
2: 3
3: 42
4: 477
Right 901863410 1:12088910-12088932 GGGCTTCAGCTGAGTGTGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901863406 Original CRISPR GCTGAAGCCCAGGATGAAGA GGG (reversed) Intronic
900571576 1:3361247-3361269 GCTGAAGCCCATGCTGAGGAGGG - Intronic
900619212 1:3579340-3579362 CCTGAAGACCAGGTTGAAGCAGG - Intronic
900781728 1:4623042-4623064 GTTGAGGCCCAGGCTGAAGATGG - Intergenic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901120375 1:6887040-6887062 GCTTAAGCACAGGACTAAGAAGG - Intronic
901636919 1:10674821-10674843 GGTGAGGCCCAGGAAGAAGTTGG - Intronic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
902385029 1:16071669-16071691 GAGGAAGCCCAGGCTGCAGAAGG + Intronic
902516142 1:16990599-16990621 GCTTGAGCCCAGGAGGAAGGAGG - Intronic
902926241 1:19697679-19697701 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
904212255 1:28893686-28893708 GCTCAGGCCCTGGCTGAAGAAGG + Intronic
904502870 1:30926573-30926595 GCTGGAACCCAGGAGGCAGAAGG + Intergenic
904854308 1:33485490-33485512 GCTTAAGTCCAGGAGGCAGAGGG - Intronic
905726461 1:40256161-40256183 GCTGAAGTCAAGAGTGAAGAGGG + Intergenic
906104305 1:43282864-43282886 GCTGAAGATGAGGATGATGATGG - Exonic
906128730 1:43443189-43443211 GCTGGAGCGCCAGATGAAGATGG + Exonic
906367040 1:45219135-45219157 CCTGTCGCCCAGGATGGAGATGG - Intronic
906780438 1:48568425-48568447 GCTCTACCCCAGGATGAACAGGG - Intronic
906980362 1:50622375-50622397 GCTGAAGCCAAGGCTGAAAAGGG - Intronic
907854894 1:58293287-58293309 GCTGATGTCAAAGATGAAGAAGG - Intronic
910688161 1:89939453-89939475 GCTGAAGCCAAGGGGGCAGAAGG + Intergenic
910920760 1:92343932-92343954 GCTGATGCAAAGGAGGAAGAGGG + Intronic
911224084 1:95285146-95285168 ACAGAAGCCCATGATGCAGATGG - Intergenic
912575243 1:110665004-110665026 GCTGCAGCACAGGATCAAGTGGG + Intergenic
913196323 1:116459140-116459162 GCTACAGCCTAGGAAGAAGAGGG + Intergenic
915724140 1:158005848-158005870 GCAGAACCCCAGGCTGTAGAGGG + Intronic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
916063598 1:161118776-161118798 GATGAAGCCCAGCCTGAGGAAGG - Exonic
916324715 1:163544111-163544133 GATGAAACCCAGGATGAAGTGGG + Intergenic
916957434 1:169853744-169853766 GCTGAAGGCTGGGAAGAAGAAGG - Exonic
917633845 1:176916657-176916679 GCTGAGGGTCTGGATGAAGAGGG - Intronic
917641680 1:176989071-176989093 GCTGAAACCCAGGAGTAAAAAGG + Intronic
918044712 1:180935022-180935044 ACTGTAGCCCAGGGTGGAGAGGG + Intronic
918796641 1:188906755-188906777 GCAGATGTCCAGGATGAAAAAGG - Intergenic
918950054 1:191125692-191125714 ACAGAAGCCGAGGCTGAAGAGGG + Intergenic
919183900 1:194119532-194119554 GTTCATTCCCAGGATGAAGATGG + Intergenic
919192695 1:194244397-194244419 ACTCAAGGCCAGGATTAAGATGG - Intergenic
919756527 1:201069535-201069557 GATGAAGAGCAGGATGAAGTTGG + Exonic
920537671 1:206749907-206749929 GCTGAAACCAATGAGGAAGATGG + Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
922323292 1:224506399-224506421 GCAGAAGCCAAGGCTGAAGGAGG - Intronic
923348760 1:233083024-233083046 GCATAAGATCAGGATGAAGAAGG + Intronic
1063686006 10:8237712-8237734 ACTAAAGCCCAGGAAGACGATGG + Intergenic
1064662759 10:17622935-17622957 GCTGAAGAGCAGGATGAATAAGG + Intergenic
1064857221 10:19782823-19782845 GCTGAAGCAGAGGATGAGAATGG - Intronic
1064859646 10:19814466-19814488 GCTGAAGCGGAGGAAGAGGAGGG + Intergenic
1065321389 10:24513276-24513298 GCTGAGGGCAATGATGAAGAAGG + Exonic
1066361726 10:34737961-34737983 GCAAAGGCCCAGGAGGAAGAAGG + Intronic
1066457243 10:35583010-35583032 CATGAAGTCAAGGATGAAGAAGG - Intergenic
1066731474 10:38440767-38440789 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1067560330 10:47300607-47300629 GCCGAAGTCCAGGAGGAGGAAGG - Exonic
1069264540 10:66442050-66442072 GCAGAACCCCAGGAGAAAGAGGG - Intronic
1069422090 10:68255579-68255601 ACTTAAGCCCAGGAAGCAGAGGG + Intergenic
1069777627 10:70936138-70936160 GCTGAGGCCAAGGGTGGAGAGGG - Intergenic
1070075948 10:73135636-73135658 GCTTAAACCCAGGAGGCAGAGGG + Intronic
1070700721 10:78599874-78599896 ACTGAAGCCCAGGATGAAAAAGG + Intergenic
1071676724 10:87661628-87661650 GCAGGAGCCCAGGAAGAGGAGGG + Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1073026786 10:100493586-100493608 GGTGAAGCCAAGGATGAGGGAGG + Intronic
1075106224 10:119542056-119542078 GCGGAACCCCAGGATGGAGAAGG - Intronic
1075581687 10:123623580-123623602 GATGATGGCAAGGATGAAGAAGG + Intergenic
1075804164 10:125173365-125173387 GCTGGAACCCAGGAGGCAGAGGG - Intergenic
1076234908 10:128856059-128856081 GCTGAAGCCCTGGATAATGATGG - Intergenic
1076502104 10:130945437-130945459 GCAGATGGCCAGGAAGAAGAAGG - Intergenic
1076556271 10:131323290-131323312 GCAGAAGCCCAGGAGGAAAGAGG + Intergenic
1077102567 11:828635-828657 GATGAGGCCCAGGAGGAGGAGGG + Exonic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1078612265 11:12830949-12830971 GATGAAGGGCAGGAGGAAGAAGG - Intronic
1078758657 11:14234341-14234363 GCTGAAGGTCAGGTAGAAGATGG + Intronic
1079050125 11:17147819-17147841 GATGAAGACAAAGATGAAGAAGG + Intronic
1079319683 11:19441751-19441773 GCTGAAGCCAAGGGAGAAAATGG - Intronic
1083478128 11:62926860-62926882 CTTGAAGCCCACGATGACGAAGG + Intergenic
1083745601 11:64735046-64735068 ACTGAAGCCCAGGCAGAAGTGGG + Intronic
1083929729 11:65834047-65834069 GCTGAAGCCCAGGAGAGCGATGG + Exonic
1085259814 11:75198034-75198056 GCTGATGCCCAGCATGAGGGTGG - Intronic
1085315339 11:75541473-75541495 GCTGGAGCCCAGGCAGCAGATGG - Intergenic
1085879116 11:80444625-80444647 GAGGAAGCCCATGATGGAGAAGG + Intergenic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1087873489 11:103327131-103327153 GCTGATGCTCAGGGTGAAGCGGG - Intronic
1088033131 11:105276644-105276666 GCTGAAGAGAAGGAGGAAGAGGG + Intergenic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1088437121 11:109826708-109826730 GCTGAAGCCCAGGTCAGAGATGG + Intergenic
1088866562 11:113853203-113853225 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1090239001 11:125168609-125168631 GTTACAGCCCAGGTTGAAGATGG - Intronic
1090499460 11:127247420-127247442 GCTGCAGAGCAGGATGAAGAGGG + Intergenic
1090913652 11:131143519-131143541 TCTGAAGCTCAGGAGCAAGAAGG + Intergenic
1091396690 12:157584-157606 GGCGAAGGCGAGGATGAAGATGG - Exonic
1091719290 12:2800979-2801001 GCTGCACCCCAGGAAGAACAAGG - Intronic
1091980502 12:4860483-4860505 GCTGAAGTCCTGGGTGAAGAGGG + Intergenic
1092244529 12:6856231-6856253 GCTGAAGGCCAAGGGGAAGAGGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094588191 12:31797099-31797121 GCTTGAGCCCAGGAAGATGAGGG - Intergenic
1095110851 12:38294211-38294233 GCTGAAGACCAGGTTGAAGAGGG + Intergenic
1095938072 12:47706080-47706102 GCTCAAGCCCAGGCTAAAGGGGG - Intergenic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1096233751 12:49912203-49912225 GCTGAATCCTAGGAAGAAGGTGG + Intergenic
1096707182 12:53429645-53429667 GGTGAGGCCCAGGATGATGTTGG + Intronic
1096710868 12:53454475-53454497 GCTGACTCTCAGGATGAACAAGG - Intronic
1097279535 12:57836113-57836135 GATGAAGCCCAAGAAGATGAGGG + Intronic
1097604510 12:61736021-61736043 GCTACACCCCAGGAGGAAGAGGG - Intronic
1098064753 12:66602021-66602043 GGTGAAGCACAGGATGAGAAAGG + Intronic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1102471673 12:113163033-113163055 GCTGATGCTCAGGCTGCAGAGGG + Exonic
1102611984 12:114120388-114120410 GCTGACACCAAGGATGAACAAGG + Intergenic
1102898520 12:116617894-116617916 GCTGGAACCCAGGAGGAGGAGGG - Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1104112644 12:125718106-125718128 TCTGAATCCCAGGAAGAAAATGG - Intergenic
1104318142 12:127723253-127723275 GCTGAAGGCCAGGTTCAACATGG + Intergenic
1104990255 12:132620519-132620541 GATAAAGCCCAGCTTGAAGATGG - Exonic
1105054755 12:133088045-133088067 GCTGGAGCCCAGGAGGCAGAGGG + Intronic
1105306671 13:19173876-19173898 GTGGAAGCCGAGGCTGAAGAAGG - Exonic
1105770922 13:23611047-23611069 CCTGAAGCCCAGGCTAAAGATGG + Intronic
1106188476 13:27428821-27428843 GTTAAAGCCCAAGATGAGGATGG - Intronic
1107046294 13:35996292-35996314 ACTGAAGCGAATGATGAAGACGG - Intronic
1107452377 13:40521508-40521530 GCTGACGGCCAGAAAGAAGATGG + Intergenic
1110428820 13:75399813-75399835 TCTGCACCCCAGTATGAAGAAGG + Intronic
1111624372 13:90764876-90764898 CTTGAAGCCGAGGATGTAGAGGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1112528897 13:100181503-100181525 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1112537589 13:100275168-100275190 CCTCAAGCTCAGGATGAAGCAGG - Intronic
1113335619 13:109373354-109373376 GATGAAGTCCAGGATCAAGGTGG + Intergenic
1115864790 14:37732933-37732955 GCTGAGGCAGAGGAAGAAGAGGG + Intronic
1116061959 14:39935056-39935078 GCTGAGGACCAGGGTGAAGGAGG - Intergenic
1118324973 14:64774517-64774539 GCTGCCTCCTAGGATGAAGAGGG - Exonic
1118742433 14:68749440-68749462 GCTACAGCCCAAGAAGAAGATGG + Intergenic
1118975398 14:70671872-70671894 GCAGAAGGGCAGGATGAAGTGGG + Exonic
1119428716 14:74552041-74552063 GCTGAGGGCCAGGAGAAAGAGGG + Intronic
1120020223 14:79521726-79521748 GCTGAAGACCAGAATGAAAATGG - Intronic
1120167546 14:81217707-81217729 GCTTGAGCCCAGGAGGGAGAGGG + Intronic
1122322450 14:100863425-100863447 GCTGAAGTCCTGGCTGAAGAGGG - Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1125246258 15:37644655-37644677 GCTGAAGCTAGGGATGAAGAAGG - Intergenic
1125929383 15:43589750-43589772 GCTGGAGTCCAGGAGGAAGGGGG - Intronic
1125942550 15:43689582-43689604 GCTGGAGTCCAGGAGGAAGGGGG - Intergenic
1126126177 15:45296560-45296582 CCGGAAGCCTAGGATGAACATGG - Intergenic
1126930549 15:53644815-53644837 GCTGATGCACAGGAAGAACATGG + Intronic
1127478464 15:59356658-59356680 GCTGGAGCCCGGGAGGCAGAGGG - Intronic
1127667134 15:61158844-61158866 GATGAAGGCAAGGATGAAGTGGG + Intronic
1127736513 15:61845038-61845060 ACTGCAGCCCAGAATGATGAAGG - Intergenic
1127966961 15:63929716-63929738 GCTGAAGAGCAGGATGGAGATGG - Intronic
1128023015 15:64409352-64409374 GCTGAAGCCCAGCTTTCAGAAGG + Intronic
1128135231 15:65258255-65258277 GCTAAAACCCAGCAGGAAGAAGG + Exonic
1128674904 15:69601376-69601398 GCTGAAGCTGAGGCTGAGGAGGG - Intergenic
1129154540 15:73709650-73709672 GCTGAGGACCAGGATGGGGAGGG + Exonic
1129388605 15:75209235-75209257 GCTGAGGCCCAGCATGCAGTGGG - Intronic
1130139929 15:81216432-81216454 GCTGAAGCTGAGGCTGAAGAGGG - Intronic
1130406819 15:83609992-83610014 GCTGGAACTCAGGCTGAAGAAGG + Intronic
1130536347 15:84787561-84787583 GCAGACTCCCAGGAAGAAGATGG - Intronic
1131693813 15:94854792-94854814 GCTGAAGCCCATGCTGGAAAGGG - Intergenic
1132210824 15:100020922-100020944 GGAGAAGCCCAGGAGGAAGCAGG - Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133162010 16:3918079-3918101 GCTGAAGCCATGGAAGAAGAAGG + Intergenic
1135220303 16:20609368-20609390 AGTCAGGCCCAGGATGAAGATGG - Intergenic
1135504886 16:23027695-23027717 GCAGAAGTCCAGGAGGGAGATGG - Intergenic
1135757820 16:25112409-25112431 CCTGAAACTCAGGATGACGAGGG + Intronic
1136137771 16:28267811-28267833 GCTGAACCCCAGGAGGACTAGGG + Intergenic
1136458375 16:30395228-30395250 GCTGCAGCCCAGGAGGCACACGG + Exonic
1136495230 16:30639052-30639074 GCTGGAACCCAGGAGGCAGAGGG + Intergenic
1136646531 16:31624050-31624072 GCTGAAGCCCAAGATCAAGGAGG + Intergenic
1136658609 16:31732183-31732205 GCTGGAGCCCAAGATCAAGGAGG - Intronic
1137380098 16:47990332-47990354 GCTGTAGCCCTGGAAGATGATGG + Intergenic
1137672662 16:50288322-50288344 GCTGAAGGCAATGATGATGAGGG - Exonic
1138270553 16:55692777-55692799 CCAGCAGCACAGGATGAAGAGGG + Intronic
1138539836 16:57681115-57681137 GATGAATCCCAGGATTGAGAAGG + Intronic
1139337960 16:66246348-66246370 GCTGAAGATCAGAATGCAGATGG + Intergenic
1139440481 16:66964165-66964187 GCTGAAGCCCAGGTTCCAGCAGG + Intronic
1139508554 16:67412647-67412669 GCTGTGGCCAAGGATGAAGCAGG - Intronic
1139668037 16:68471944-68471966 GCTTGAGCCCAGGAGGTAGAGGG + Intergenic
1139703729 16:68725970-68725992 GCTTGAGCCCAGGAGGCAGACGG + Intergenic
1140194845 16:72847603-72847625 GATGGAGGCCAGGATAAAGAAGG + Intronic
1140615337 16:76656197-76656219 GCTGAAAAACAGGATGAAAAAGG - Intergenic
1141579737 16:84988983-84989005 GCTGCAGCCAAGGAAGGAGAGGG + Intronic
1141746501 16:85929887-85929909 GCTGGAGCCCAGGAGGAGGGCGG - Intergenic
1142026787 16:87818694-87818716 ACCCAAGCCAAGGATGAAGATGG + Intergenic
1142348767 16:89570452-89570474 GCTGAAGCCCAAGCTGAGCAGGG - Intergenic
1143304636 17:5936661-5936683 TCTGAGGCAAAGGATGAAGAAGG - Intronic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1143717561 17:8785903-8785925 GCTGCAGCTCAGGATGAGGCCGG - Intergenic
1143923650 17:10350668-10350690 GCTGAAGCCCAGGATGTCAATGG + Exonic
1143952634 17:10645819-10645841 GGTGAAGCCCAGGATGTCAATGG + Exonic
1146153110 17:30494688-30494710 GCTGGAACCCAGGAGGCAGAGGG - Intronic
1146267541 17:31462960-31462982 GCTGAGGCTCAGGATCAGGAGGG - Intronic
1146688077 17:34855195-34855217 GGTGACTCCCAGGATGGAGATGG + Intergenic
1146756097 17:35433192-35433214 GCCGCAGCCCAGGATGGGGAGGG - Exonic
1147350541 17:39839655-39839677 GCTTGAGCCTGGGATGAAGAGGG - Intronic
1147636746 17:41968592-41968614 GCTGAAGCCTGGGCTGGAGAAGG + Exonic
1148218374 17:45846225-45846247 ACCGAAGCCAAGGATGGAGAAGG - Exonic
1148566301 17:48634915-48634937 TCTGAAGCCCAAGAAGAAAACGG - Intergenic
1148643438 17:49205228-49205250 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1149268615 17:54953666-54953688 CAGGAAGCCCAGGAAGAAGATGG - Intronic
1149296753 17:55267956-55267978 GCTGCAGCCCAGGAGGGTGAGGG - Exonic
1150165257 17:62935286-62935308 GTTGAAGCCCAGGAAGGTGAAGG - Intergenic
1150492239 17:65582515-65582537 GAAGAGGCCCAGGATGAAGTGGG + Intronic
1150658288 17:67055130-67055152 GATGAAGCCAAGGCTGAAGATGG - Exonic
1152007620 17:77692439-77692461 GCTGAAGAGGAGGATGAGGAGGG + Intergenic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152299632 17:79487484-79487506 GCTGAGGACGAGGATGATGATGG - Intronic
1152403179 17:80081932-80081954 GCTGGAGCTCAGGAGGAAGACGG + Exonic
1154173011 18:12064115-12064137 GCTGAGGCCCTGGAGGAAGTGGG - Intergenic
1156395051 18:36691737-36691759 CCTGCAGCCCAGGATGCTGAGGG - Intronic
1156858321 18:41808700-41808722 CCTGAGGCCCAGGATAAAGGAGG + Intergenic
1157191395 18:45585149-45585171 TCTGAAGCCCAGGAAGGAGGAGG - Intronic
1157621007 18:49017499-49017521 ACTGAGGCCCAGGAGGGAGAGGG + Intergenic
1159044196 18:63353361-63353383 GCTGAAGAACAGGTTGAGGAGGG + Intronic
1159381309 18:67663359-67663381 GCTTGAGCCCAGGATGTTGAGGG - Intergenic
1159958539 18:74537617-74537639 GCTGGACCACAGGATGCAGAGGG + Intronic
1160496953 18:79381355-79381377 GCAGAAGCCCAGGAGGAAGGGGG + Intergenic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160745131 19:707986-708008 GATGTACCCCAGGCTGAAGAAGG - Intergenic
1161269298 19:3381073-3381095 GTTGAACCCCAGCATGCAGATGG - Intronic
1161298799 19:3532936-3532958 GGGGAGGCCCAGGATGAAGCGGG + Intronic
1161313633 19:3607874-3607896 GCCGAAGGCCAGGAGGAGGAAGG - Intergenic
1161555968 19:4942853-4942875 GCTGGAGCCCAGGAGGTCGAGGG + Intronic
1161679578 19:5673168-5673190 GCTGAAGCCCAGGTCCCAGAGGG + Intergenic
1161746676 19:6064387-6064409 GCTGATGGTCAAGATGAAGATGG + Intronic
1163344594 19:16732426-16732448 CCTGAAGCCCAGTACGAAGAGGG - Intronic
1163441079 19:17323006-17323028 GCTGAAGCCAGGGCTGAAGTTGG + Exonic
1163592559 19:18202795-18202817 GCCCAAGCCCAGGCAGAAGATGG + Intronic
1164328027 19:24219054-24219076 GCTGAGGCCCATGGTGAAAAAGG - Intergenic
1164339869 19:24381253-24381275 GCTGAAGCCTATGGTGAAAAAGG + Intergenic
1164365591 19:27578719-27578741 GCTGAAGCCATGGCAGAAGAAGG + Intergenic
1164766612 19:30777296-30777318 GGTGCAGCTCAGGATGAGGAAGG + Intergenic
1165376004 19:35442451-35442473 GCTGGAACCCAGGAGGAGGAGGG + Intergenic
1165792128 19:38499046-38499068 GCTGAGCCCCAGGAGGAAGGTGG + Intronic
1166103206 19:40583441-40583463 GTTGCAGCCCAGGAGGAGGAAGG - Exonic
1166732870 19:45068443-45068465 GCTGAAACTGAGGATGCAGAAGG + Exonic
1166817253 19:45553769-45553791 GCCGCCGCCCACGATGAAGATGG + Intronic
1166894123 19:46013099-46013121 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1168407000 19:56115685-56115707 GCTGATGCCCCCGAGGAAGACGG - Intronic
924998771 2:387009-387031 GCAGAAGCCCAGGACAGAGAAGG - Intergenic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
925030464 2:646950-646972 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
925616343 2:5747731-5747753 GCTGAAGCTCAGGATGTAGCTGG - Intergenic
926278148 2:11421593-11421615 GCTGAGGCTCAGGAGGATGAGGG - Intergenic
926292053 2:11539133-11539155 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
926394336 2:12425905-12425927 GCTGAAAGCCAGGATAAGGAGGG - Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
926629371 2:15122882-15122904 GCTGAAGCTGAGGCTGAAGGAGG + Intergenic
926809912 2:16746705-16746727 CCTAAAGCCCAGGTTGAAAAAGG - Intergenic
927849147 2:26487969-26487991 ACTGAAGCCCAAGGTGATGAAGG - Intronic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
928153739 2:28857014-28857036 GCTGGAACCCAGGAGGCAGAGGG - Intronic
928392998 2:30923576-30923598 GGTGAAGCTGGGGATGAAGAAGG + Intronic
929683758 2:44016937-44016959 GCTGAGGCCCAAGATGGAAAAGG + Intergenic
929885566 2:45874663-45874685 TCTGAAGGCTAGGATGAAGATGG - Intronic
930321821 2:49864612-49864634 GCTGATGCCCAGGCAGAAGTGGG + Intergenic
931433424 2:62228050-62228072 TCTGTTGCCCAGGATGAAGTGGG + Intergenic
932571111 2:72938787-72938809 TCTGAAGCCCAGGTTGGAGGTGG - Intergenic
932846219 2:75138215-75138237 GCAGAGGCCCAGCAGGAAGACGG + Intronic
934655453 2:96114848-96114870 GCGGAAGTCCTGGTTGAAGATGG + Exonic
935875821 2:107505915-107505937 ACTGAAGCCTGGGATTAAGAGGG - Intergenic
936578619 2:113676110-113676132 TCTGAATCCCAGGAAGAGGAGGG - Intergenic
936607405 2:113972350-113972372 CCTGAAGCCAAGGATGCACAGGG + Intergenic
936960913 2:118073662-118073684 GCTGAGGCCAAGGAGAAAGAGGG + Intergenic
937551371 2:123096176-123096198 GGTGAAGCCCAAGATGAGGCTGG - Intergenic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
938903982 2:135821561-135821583 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
939078375 2:137630074-137630096 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
940566795 2:155374143-155374165 GTTGAATCCCAGGATGATGATGG + Intergenic
940623561 2:156144756-156144778 TTTGAGGCCCAGGATAAAGAGGG - Intergenic
941011680 2:160307301-160307323 GGTGAAGCTCTGGATGGAGAGGG + Intronic
943018211 2:182540279-182540301 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
943246274 2:185455576-185455598 GATGAAACCCAGGATCCAGAGGG + Intergenic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
947223678 2:227819884-227819906 GCTTAAACCCAGGAGGCAGAAGG - Intergenic
948086604 2:235255803-235255825 GGAGAAGTCCAGGAAGAAGAGGG - Intergenic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
949057183 2:241934545-241934567 GCTCCAGACCAGGATGCAGAAGG - Intergenic
949072005 2:242030986-242031008 ACTGAGGCCCAGGGTGAAGTGGG - Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1169346028 20:4828702-4828724 TCTAAGCCCCAGGATGAAGAGGG + Intergenic
1170552928 20:17492407-17492429 GCTGGAGCCCAGGATGTACTAGG - Intergenic
1170854596 20:20039376-20039398 GATGATGCCCAGGATGAACTGGG - Intronic
1172151356 20:32792688-32792710 GCTGAAGCCCATGTTGGAGTGGG + Exonic
1172264444 20:33598840-33598862 GCTGAAGCCATGGCAGAAGAAGG - Intronic
1172444752 20:34987153-34987175 GCTGAAGCCTAGGATGTCCATGG - Exonic
1172771443 20:37384657-37384679 GCTTAAGCCCAAGAAGAAGAAGG + Intronic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1173825898 20:46047456-46047478 GCTCATGCCCAGGAAGGAGAGGG - Exonic
1174079185 20:47958865-47958887 CCTGTAGCCCAGTATGAACAGGG - Intergenic
1174379354 20:50146744-50146766 CGTGAAGCCCAGGAAGGAGAAGG + Intronic
1174406614 20:50306991-50307013 GATGAATTCCAGGAAGAAGAGGG - Intergenic
1174458776 20:50668254-50668276 GCTGAGGACCAGGATACAGATGG - Intronic
1175183300 20:57163390-57163412 GCTGACAGCCAGCATGAAGATGG + Intergenic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1178383869 21:32133991-32134013 GCTGAGGCCCAGTCTGAAGGTGG - Intergenic
1178954028 21:37007091-37007113 GCGGAGGCCCAGGATGTAGCTGG + Intronic
1179586189 21:42375470-42375492 GCTGGGGCCCGGGAGGAAGAAGG - Intronic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1180236762 21:46465489-46465511 GCTCAAACCCAGGAGGCAGAGGG + Intronic
1181261633 22:21602234-21602256 TCTGAAGCCTGGCATGAAGAAGG + Intronic
1181368530 22:22398487-22398509 CCAGCAGCCCAGGATGAAGGAGG - Intergenic
1181703055 22:24631751-24631773 GCTGCAGCCCAGGCTGACCAGGG + Intergenic
1181855074 22:25775456-25775478 TCTGAAGCCCAAGATGCTGAGGG - Intronic
1181870448 22:25894179-25894201 GCTGAAGCCTAGTATGATCAGGG - Intronic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1182921326 22:34082534-34082556 GCTGGAACCCAGGAGGCAGAGGG - Intergenic
1183204016 22:36406028-36406050 GCTGATGCCCAGGTTTAAGGTGG + Intergenic
1183418595 22:37697174-37697196 GCTGAATGCCTGGATGGAGAGGG + Intronic
1183717007 22:39539252-39539274 GCTTGAGCCCAGGAGGCAGAAGG - Intergenic
1183862660 22:40681012-40681034 GATGATGCCCAGGAGGCAGATGG - Exonic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
1184437229 22:44486596-44486618 GATGAAGAACAGGATGAGGAAGG + Intergenic
1184463245 22:44652296-44652318 GATGAAGAGGAGGATGAAGAAGG + Intergenic
1184487935 22:44792402-44792424 GGTGAGGCCCAGGAGGAGGAAGG - Intronic
1184885430 22:47342224-47342246 ACTGTAAACCAGGATGAAGAGGG + Intergenic
1185403682 22:50632756-50632778 GCTTAAACCCAGGAGGCAGAGGG - Intergenic
949239174 3:1849477-1849499 GCTCAAGCTCAGGATGAAAAAGG + Intergenic
949940432 3:9150322-9150344 GCTGGAGCCCAGAAGTAAGAAGG + Intronic
950024776 3:9812587-9812609 GCTTGAACCCAGGAGGAAGAGGG + Intronic
950119937 3:10475036-10475058 GCAGAAGCCCAGGCTGAAACTGG - Intronic
950425013 3:12920518-12920540 GGCGAAGGCCAGGATGAAAATGG + Exonic
950653700 3:14423672-14423694 ACTGAGGCCCAGGCAGAAGATGG - Intronic
951663309 3:25094632-25094654 GCTTGAGCCCAGGAGGCAGAGGG + Intergenic
951775039 3:26300985-26301007 GTTGAAGCACAGGGTTAAGATGG + Intergenic
952511160 3:34057520-34057542 ACTTCAGCCCAGGATGAAGTGGG + Intergenic
952730239 3:36630900-36630922 GCTGAAGTCCAGAGAGAAGATGG - Intergenic
952827129 3:37533343-37533365 GATGGAGCCCGGGAGGAAGATGG - Exonic
954364429 3:50138653-50138675 ACTGAACCCCAGGTTGGAGAGGG - Intergenic
955266197 3:57447754-57447776 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
955341944 3:58131669-58131691 GCTGAACCCCATGAAGGAGAAGG - Intronic
957319569 3:78611850-78611872 GGTGAAGCACAGGGAGAAGATGG + Intronic
957473820 3:80697884-80697906 GCAGTAGCCCAGGATGCAGTGGG - Intergenic
958707712 3:97676855-97676877 GCTAAAATCGAGGATGAAGAAGG + Intronic
958843530 3:99237999-99238021 GCAGTAGCCCTGGATGATGATGG + Intergenic
959083184 3:101824006-101824028 GCTTGAGCCCAGGAGGCAGAAGG + Exonic
959577687 3:107952025-107952047 ACTGAAGCCCAGAGTTAAGAAGG + Intergenic
959631425 3:108511339-108511361 GAAGAAGCCCAGGCTGAAGGTGG + Intronic
960177129 3:114531197-114531219 GCTGGAACACAGGAGGAAGAAGG - Intronic
960879098 3:122327153-122327175 ACTTGAGCCCAGGATGCAGAAGG + Intronic
960966813 3:123111238-123111260 GGTGAAGCTCTGGATAAAGAGGG - Intronic
960993678 3:123327627-123327649 GGTGCAGCGCAGGATGAGGAAGG + Exonic
961659812 3:128462775-128462797 GCTGCAGCCCAGCATGTTGAAGG + Exonic
961685262 3:128625573-128625595 GGTGAAGAACAGGATGTAGAAGG + Exonic
962258286 3:133886981-133887003 GTGGAAGCCCAGGATGCAGGAGG + Intronic
962463367 3:135635142-135635164 TCTGAAGCCGAGGAAGAGGAAGG + Intergenic
964636377 3:158862045-158862067 CCTGGATCCCAGGATAAAGATGG - Intergenic
965603177 3:170474484-170474506 CCTGAAGGCCAGGATGAGGTTGG - Intronic
965733461 3:171796838-171796860 GCTGAAGAAGAGCATGAAGATGG - Intronic
966756767 3:183378455-183378477 GTTGAGGCCCAGGCTGGAGAGGG + Intronic
967219786 3:187238869-187238891 GATGCAGGCCAGGATGGAGAAGG - Intronic
967222015 3:187255314-187255336 GCTGACAGCCAGGAAGAAGAAGG + Intronic
967237888 3:187405474-187405496 ACTGAAGCCCATCATGAAGGAGG + Intergenic
967488316 3:190059460-190059482 GCTGGAGCCCAGGAAGGAAAAGG - Intronic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
969368527 4:6715414-6715436 GCAGAAGCCCAAGATAGAGATGG - Intergenic
969519445 4:7667413-7667435 GCAGAGGCCTAGGATGAAGCTGG - Intronic
970352313 4:15214987-15215009 GCTGTTACCAAGGATGAAGATGG - Intergenic
970831312 4:20343582-20343604 GCTTAAGCCCAGGAGGTTGAGGG - Intronic
971004226 4:22356436-22356458 ACTAAAGCCAAGGCTGAAGAGGG + Intronic
971249426 4:24961165-24961187 GCTGAAGGACAGAAAGAAGAAGG + Intronic
971703226 4:30007491-30007513 TTTGCAGCCCAGGATGCAGATGG + Intergenic
972124938 4:35752487-35752509 GATGAAGCACAGGAGAAAGATGG - Intergenic
972448945 4:39176892-39176914 TCTGAAGCCCAGGCTGGAGTGGG - Intergenic
974449278 4:62030656-62030678 GATGAAGCTGAGAATGAAGATGG - Intronic
974487777 4:62526469-62526491 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
977298137 4:95233850-95233872 GCTTAAACCCAGGAGGCAGAAGG + Intronic
977636167 4:99300944-99300966 ACTGAAGCCCAAGATGTCGAGGG + Intergenic
979257856 4:118623377-118623399 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
979330493 4:119417185-119417207 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
979588495 4:122449436-122449458 GCTGAAGATCAGGATGGAAAAGG + Intergenic
979693283 4:123583580-123583602 GCTGGAGCCCAGGAGGCAGAAGG - Intergenic
982362353 4:154533286-154533308 GCTGGAACCCAGGAAGCAGAGGG + Intergenic
982447571 4:155511522-155511544 GGTGAGGACCATGATGAAGAAGG - Intergenic
982841471 4:160193331-160193353 GCTTAAACCCAGGAGGCAGAAGG - Intergenic
983578668 4:169285988-169286010 GCTGGAGCCCGGGAGGCAGAGGG - Intergenic
984508815 4:180654294-180654316 GCTGAAGACGAGGCTGAATAGGG + Intergenic
984508987 4:180656080-180656102 GCTGCATTCCAGGATGAAGGTGG - Intergenic
984624208 4:181987377-181987399 GGTGTAGTGCAGGATGAAGAGGG - Intergenic
985170054 4:187139135-187139157 TCTCATGCCCAGGAAGAAGAGGG + Intergenic
985508114 5:296321-296343 GCAGAGGCCCAGGGTGAAGTGGG - Intronic
985739922 5:1609348-1609370 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
985873161 5:2575070-2575092 GTGGAATCCCAGGATGAACATGG + Intergenic
988601016 5:32639501-32639523 AGTGAAGCCCAGGAAGATGAAGG - Intergenic
988684343 5:33513266-33513288 CCTGAAGCCCAGGTTTCAGAGGG - Intergenic
990341303 5:54825869-54825891 GATGAACCCAAGGATGAAGCAGG + Intergenic
990629512 5:57652485-57652507 GCTGAAGCCATGTATGAAGGTGG + Intergenic
991709325 5:69392324-69392346 GCTGGAGCCCAGTGTTAAGAGGG - Intronic
996052758 5:118951253-118951275 GCAGAAGCCGAGGAAGAAGTGGG + Intronic
996712115 5:126553727-126553749 GCTTTAGTCCAGGAGGAAGAGGG + Intronic
996761121 5:126986906-126986928 TCTGGAGGCCAGGAAGAAGATGG + Intronic
997441603 5:133912491-133912513 GCTTAAGCCCAGGAGGTCGAGGG + Intergenic
997624450 5:135322144-135322166 ACTGAGGCCCAGGGTGCAGAGGG - Intronic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
999228729 5:150048880-150048902 GCTGATGCCCAGGATGTGGTAGG - Intronic
999250698 5:150180582-150180604 GCTGAAACCCAAGAAGATGAAGG + Intronic
1001834119 5:174816531-174816553 GCTTGAACCCAGGAGGAAGAGGG - Intergenic
1002170400 5:177371283-177371305 GCTGTGGCCCAGGAGGAAGGGGG + Intronic
1002339570 5:178506091-178506113 GCTGAAGGCCGGGAGGAGGAGGG + Intronic
1002353382 5:178602004-178602026 GCTTGAACCCAGGAGGAAGAAGG + Intergenic
1002769385 6:277889-277911 GCCAAAGCTGAGGATGAAGAAGG - Intergenic
1002839816 6:896166-896188 GCTGGAACTCAGGATGCAGAGGG - Intergenic
1004385766 6:15171569-15171591 TGTCAAGCCCAAGATGAAGATGG + Intergenic
1004740207 6:18452865-18452887 GCTTGAGCCCAGGAGGCAGAAGG - Intronic
1005016624 6:21380563-21380585 TCTGAAGCCCAGGTTGGAAAGGG + Intergenic
1005715583 6:28544162-28544184 GCCGGAAGCCAGGATGAAGAGGG - Intergenic
1005922907 6:30416992-30417014 GCTGAGGGCCTGGATGATGATGG + Intergenic
1005972961 6:30775831-30775853 GCTGGAACCCAGGAAGAAAAAGG - Intergenic
1006238959 6:32660988-32661010 GCTGAAGGCCTGGAAGAACATGG - Intronic
1006922108 6:37633889-37633911 GCTGAAGCCCAGAGTGGGGAAGG - Exonic
1006994639 6:38247434-38247456 GCTGAAGACCAGGCAGCAGATGG + Intronic
1007184844 6:39960935-39960957 GCTTGAGACAAGGATGAAGATGG + Intergenic
1007389001 6:41539049-41539071 GGTGAAGACCAGAAAGAAGAGGG + Intergenic
1007433772 6:41793341-41793363 GCTGGAACCCAGGAGGCAGAAGG - Exonic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1007968200 6:46023428-46023450 GCTAAAGCCCAGGATGTGGTTGG + Intronic
1008799739 6:55352004-55352026 GCTGGAGATCAGGAGGAAGAAGG + Intronic
1011461608 6:87611017-87611039 GCTTAAGCCCAGGAGGTGGAGGG - Intronic
1012280014 6:97317015-97317037 GCTGAAGCCCAGAATAGAGTGGG + Intergenic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1014619366 6:123646572-123646594 GCTGAGGAAAAGGATGAAGAGGG + Intergenic
1014773651 6:125484740-125484762 GCTGTAGCTGAGGAAGAAGATGG + Intergenic
1014787015 6:125630903-125630925 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1015228305 6:130883919-130883941 TCTGAGGCCCAGCATGGAGAAGG - Intronic
1015289661 6:131524323-131524345 GCTGTAGCCTAGGAAGATGATGG - Intergenic
1015768981 6:136749776-136749798 ACTGAGGGCCAGGATGAATAAGG + Intronic
1016843581 6:148548404-148548426 GCTGAAGCCCGCGGTGGAGAGGG - Exonic
1018414976 6:163592971-163592993 TCCGAGGCCCGGGATGAAGAAGG - Intergenic
1018641401 6:165907579-165907601 GCTGAGGAGCAGGATGATGAGGG - Intronic
1018800658 6:167219690-167219712 GCTGTATCCCAGGCTGCAGAGGG - Intergenic
1018809500 6:167287617-167287639 GCTGTATCCCAGGCTGCAGAGGG + Intronic
1019441931 7:1051893-1051915 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1020022592 7:4877993-4878015 GCTGGCGCCCAGGCTGGAGAAGG + Exonic
1020083926 7:5300498-5300520 GTAGACGCACAGGATGAAGAGGG - Exonic
1020267320 7:6569761-6569783 GCCTATGCCCAGGATGAACAAGG + Intergenic
1020750809 7:12139155-12139177 GCTGAAGGCAAAGATCAAGACGG - Intergenic
1022970408 7:35511706-35511728 GCTGAAGCCAAGGAGGTATAAGG + Intergenic
1023089843 7:36607688-36607710 CCTCAAGCCCAGGATGGACAGGG - Intronic
1023399845 7:39784663-39784685 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1023843921 7:44110739-44110761 GCTGAAGCCCACGAAGAAGGTGG - Exonic
1024072782 7:45800447-45800469 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1024177053 7:46851312-46851334 GCTGTTCCTCAGGATGAAGATGG - Intergenic
1024268446 7:47624418-47624440 TCTGAAGCATAGGATGAAAAGGG + Intergenic
1024349729 7:48351516-48351538 GCAGAAACCCAGGGAGAAGATGG - Intronic
1024358625 7:48444557-48444579 GATGAAGGTCAGGATGAAGCAGG - Intronic
1024650558 7:51399733-51399755 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1025054676 7:55755317-55755339 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1025170226 7:56749757-56749779 GGAGAGGCCCAGGATGCAGATGG - Intergenic
1025184394 7:56845949-56845971 ACTGAACTCCAGGAGGAAGAGGG + Intergenic
1025578429 7:62678332-62678354 TCTGAAGCCCATGGTGAAAAAGG + Intergenic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1025600585 7:62992749-62992771 TCTGAAGCCAAGGAGGAACAAGG + Intergenic
1025701657 7:63825949-63825971 GGAGAGGCCCAGGATGCAGATGG + Intergenic
1025911243 7:65830531-65830553 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1026171062 7:67954342-67954364 GGAGAGGCCCAGGATGCAGATGG + Intergenic
1027247006 7:76374214-76374236 GCTGAAGCCCAGGTTTGAGAAGG + Intergenic
1027609861 7:80347220-80347242 GCTTAAGCCCAGGAGGTAGAGGG + Intergenic
1027804141 7:82794552-82794574 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
1029558561 7:101287266-101287288 GCTGAGGCCTGGGATGAGGATGG + Intergenic
1029736622 7:102469015-102469037 GCTGAAGCACAGGGTGGCGATGG - Exonic
1030216489 7:107048322-107048344 CTTGAAGCCCAGGATGATCAGGG + Intronic
1030545743 7:110892924-110892946 CCTGAAGCCAAGGATGAGGGTGG - Intronic
1032050159 7:128644136-128644158 ACTGAACTCCAGGAGGAAGAGGG - Intergenic
1033099438 7:138457928-138457950 GCGGAAGCACAGGATGGATATGG + Intergenic
1033146266 7:138872819-138872841 CCTTAAGCCCAGGAGGTAGAGGG + Intronic
1033401092 7:141026117-141026139 GCTTGAGCCCAGGACGCAGAGGG - Intergenic
1033563937 7:142560554-142560576 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033564326 7:142563868-142563890 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1034996443 7:155580225-155580247 GCTGATTCCCAGGATGGTGAGGG + Intergenic
1035005864 7:155660154-155660176 GCTTGAGCCCAGGAGGCAGAGGG - Intronic
1036531290 8:9590197-9590219 GATGAAGTCCATGATGTAGACGG - Intronic
1036645055 8:10607634-10607656 GTAGAGGCCCAGGATGCAGAAGG - Exonic
1037531348 8:19777352-19777374 GCGGAAGTCCTGGATCAAGATGG + Intergenic
1038163746 8:25064760-25064782 GCTTAAGCCCTGAATGCAGATGG + Intergenic
1038444725 8:27595378-27595400 GCTGAAGCTAAGAATGAACACGG - Intergenic
1038681335 8:29671099-29671121 GAAGAAGCACAGGAAGAAGACGG - Intergenic
1038711810 8:29953950-29953972 GCTGAACACCAAGTTGAAGATGG + Intergenic
1039340779 8:36647507-36647529 GGAGAAGCCCAGGAAGAAGCAGG + Intergenic
1039828153 8:41192201-41192223 GCTGGAGCCCGGGAGAAAGAGGG - Intergenic
1041807257 8:61865543-61865565 GCTGAAGACCAGAAGGGAGAAGG + Intergenic
1044189082 8:89293058-89293080 GTTGAAGAACAAGATGAAGAAGG - Intergenic
1045051102 8:98326798-98326820 GCTGAAGCCCAGAATCATGAAGG + Intergenic
1045930544 8:107620662-107620684 GCTGAAGGACAGTATGAGGAAGG - Intergenic
1045965975 8:108024935-108024957 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1046729019 8:117705293-117705315 GCTGGAGCCAAGGGTGATGATGG - Intergenic
1047513155 8:125530757-125530779 GCTTAAGCACAGGATAAGGAGGG + Intergenic
1047880350 8:129186110-129186132 AATGAAGCCCTGGATGAGGAGGG + Intergenic
1048985349 8:139731997-139732019 GCTGGAGCCCACGAAGGAGACGG + Exonic
1049015172 8:139914860-139914882 GCTTAAACCCAGGACGAGGAGGG - Intronic
1049276631 8:141723361-141723383 GCTGGAGCCCAGCATGAATCCGG - Intergenic
1049575380 8:143387408-143387430 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1049677069 8:143894818-143894840 TCAGAAGCCCAAGATGGAGAGGG + Intergenic
1049731222 8:144179546-144179568 GCTGGAGGCCAGGAGGATGATGG - Exonic
1050092742 9:2031857-2031879 GCTGAAGCCTCAGAGGAAGAAGG - Intronic
1050108309 9:2188807-2188829 GCTGAGAACCAGGATGAACAAGG - Intronic
1050626444 9:7508914-7508936 GCTGAAACCCAGGAGGGTGATGG + Intergenic
1051764899 9:20513143-20513165 GCTGTCTGCCAGGATGAAGAAGG - Intronic
1053187018 9:36024925-36024947 GCACCAGCCCAGGATGGAGAAGG - Intergenic
1054813755 9:69455373-69455395 GCTGAGGCCCAGGATGGTGCGGG + Intronic
1055026537 9:71728397-71728419 GCTTGAGCCCAGGAGGCAGAGGG + Intronic
1055637938 9:78296561-78296583 TTGGAAGCGCAGGATGAAGAAGG - Intergenic
1056340611 9:85627698-85627720 GCTGAAGAGCAGGAAGAAGAAGG - Intronic
1056430882 9:86526734-86526756 ACTGAAGCCCATGATGAGGTGGG - Intergenic
1056708002 9:88968021-88968043 GCAGAACCCCAGGATGCAGTGGG + Intergenic
1057854373 9:98591317-98591339 GCAGGAGCACAGGATGGAGAAGG + Intronic
1057993398 9:99797053-99797075 GGTGAAGTCCAGGGTGAACAAGG - Intergenic
1059744179 9:117184126-117184148 GCTGAGGCCCAGGGTTGAGAAGG + Intronic
1060236016 9:121863093-121863115 GCAGGAGCCCAGGAGGAAGCAGG - Intronic
1060860310 9:126948632-126948654 GCTGAAGCTGAGGAGGCAGAAGG - Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1061072785 9:128322012-128322034 GCAGAAGCCCATGGTGCAGAGGG + Intronic
1061162142 9:128901754-128901776 GCTCTTGCCGAGGATGAAGAGGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1185683702 X:1909789-1909811 GCTGAGGCCCAGGAGGGAGGGGG - Intergenic
1187225463 X:17372193-17372215 GCTCCAGCCCAGAAGGAAGAAGG - Intergenic
1187324960 X:18278263-18278285 ACTGAAGCAAAGGCTGAAGAGGG + Intronic
1189430785 X:40945084-40945106 GGGTAAGCCCAGAATGAAGACGG + Intergenic
1190094460 X:47467478-47467500 GCTGAGGCCCAGCGTGAACATGG - Exonic
1192070609 X:67936591-67936613 TCTTAATCCCAGGATGAAGCTGG + Intergenic
1192234087 X:69285260-69285282 ACTGAAGCCCAGGGAGAGGATGG + Intergenic
1192244206 X:69359550-69359572 GATGAAGACAAGGATGCAGAAGG - Intergenic
1192246564 X:69378018-69378040 GCTGCAGCTCAGGCTGAACAAGG + Intergenic
1193440906 X:81538188-81538210 GGTGAAGCCCACGCTGAAGGAGG - Intergenic
1194859907 X:98985322-98985344 GCAGAAACTCAGGATGAAGTTGG - Intergenic
1196297283 X:114012577-114012599 GCTTAAGCCCAGGAGGCAGGAGG + Intergenic
1198180297 X:134201397-134201419 GCTTGAGCCCAGGAGGCAGAGGG - Intergenic
1199842615 X:151665498-151665520 GATGGAGACCAGGATGAGGAAGG + Intronic
1200116493 X:153771901-153771923 GTTGGAGCCCAGGATGGTGAGGG - Exonic
1200794992 Y:7332857-7332879 GCTGAAGCCCAGGACGCTGAGGG - Intergenic
1201268103 Y:12228279-12228301 GCAGAAGCACAGTTTGAAGAAGG - Intergenic