ID: 901864945

View in Genome Browser
Species Human (GRCh38)
Location 1:12099695-12099717
Sequence GTGTGTAAGTACACTAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901864945_901864947 9 Left 901864945 1:12099695-12099717 CCTAGATTAGTGTACTTACACAC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 901864947 1:12099727-12099749 ATGTAGCCTACTGCACACCTAGG 0: 2
1: 16
2: 174
3: 661
4: 1330
901864945_901864949 17 Left 901864945 1:12099695-12099717 CCTAGATTAGTGTACTTACACAC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 901864949 1:12099735-12099757 TACTGCACACCTAGGTTCTATGG 0: 1
1: 9
2: 109
3: 643
4: 1246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901864945 Original CRISPR GTGTGTAAGTACACTAATCT AGG (reversed) Intronic
901864945 1:12099695-12099717 GTGTGTAAGTACACTAATCTAGG - Intronic
903529874 1:24021935-24021957 CTGGGGAAGTAAACTAATCTAGG + Intergenic
911463515 1:98221473-98221495 CTGTGTAATTACACTGAACTGGG - Intergenic
911944107 1:104084186-104084208 GTGTGTATGTACACTTTTGTTGG - Intergenic
912075130 1:105864688-105864710 ATGTGTAACTACAATAATATAGG + Intergenic
917085070 1:171296841-171296863 GTTTGCAAGTACACTAATTTGGG + Intergenic
918782134 1:188714077-188714099 GTGTGTAGGTAAAGTAATCTAGG + Intergenic
919557593 1:199078731-199078753 GTGTGTAAATAAACAAATTTTGG + Intergenic
921308809 1:213822834-213822856 GGATGTCATTACACTAATCTAGG - Intergenic
923987136 1:239394105-239394127 GAGTGTAACTAAACAAATCTGGG + Intronic
1064444515 10:15381638-15381660 CTCTGAAAGTACACTATTCTTGG + Intergenic
1065256369 10:23873135-23873157 CAGTGTAAGGACAATAATCTGGG + Intronic
1071361822 10:84854441-84854463 GTGTTTTACTTCACTAATCTTGG + Intergenic
1079536903 11:21526136-21526158 GTGGGTAAATACACTAATGTGGG + Intronic
1079949163 11:26780310-26780332 ATGTGTAAATACACTTTTCTTGG - Intergenic
1086273747 11:85098970-85098992 GGGAGTCAGTACATTAATCTAGG + Intronic
1093515523 12:19982040-19982062 GTGTCTATGTTTACTAATCTTGG - Intergenic
1094256218 12:28430037-28430059 GTGTCTTAGTACAGTAATTTAGG + Intronic
1099088861 12:78279790-78279812 GTGTGTACGTACACCAGTGTGGG + Intergenic
1099690051 12:85940348-85940370 GAGTGTATTTACACAAATCTAGG + Intergenic
1101541497 12:105669628-105669650 GTGTGTATGTACACATTTCTGGG + Intergenic
1105590499 13:21789166-21789188 GTGTGAAAATAGACTAATATAGG - Intergenic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1108948526 13:56056815-56056837 GTGCGAAAGTACAAAAATCTTGG - Intergenic
1109919957 13:69043793-69043815 GTGTTTAAGGACACAGATCTGGG + Intergenic
1110667085 13:78129630-78129652 CTGAGTAACTAGACTAATCTAGG + Intergenic
1112036052 13:95497630-95497652 GTGTTGAAGTTCACTATTCTAGG - Intronic
1129059617 15:72850283-72850305 GTGTGCAGGTACACAACTCTGGG - Intergenic
1139291820 16:65865765-65865787 ATGTGTATGTACACTTATATAGG - Intergenic
1153036076 18:763773-763795 GTGTATAAGTATAATAATCAAGG + Intronic
1155195183 18:23467577-23467599 CTGTGTAAATTCATTAATCTTGG - Intronic
1155686014 18:28551230-28551252 GTGTATATTTACACTAATTTTGG + Intergenic
1157629803 18:49083178-49083200 GTTTGTAAGTACAGTTTTCTTGG - Intronic
1158282896 18:55847288-55847310 GTGTGTAAGTAAATTCATCTTGG - Intergenic
1158738387 18:60110474-60110496 GTAGGTAAGTACATGAATCTGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929067353 2:37991680-37991702 GTGTCTAGGTACACTATTCACGG + Intronic
931609600 2:64084497-64084519 GTGTCTAAGCAAACTAATATGGG - Intergenic
933600428 2:84323724-84323746 TTGTGTAAGTACAGTGATCTGGG + Intergenic
935797863 2:106663137-106663159 GTGTGAGAGTAAACTAATCCTGG + Intergenic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
937595730 2:123670500-123670522 GAGTGTACTTACACAAATCTAGG + Intergenic
945926671 2:215812472-215812494 GTGTGTAAATAAACTAATTTAGG - Intergenic
946233995 2:218311019-218311041 GTGTGTACTTACACAAACCTAGG - Intronic
1170370516 20:15643074-15643096 GTGTTTAATTGCACTAATTTTGG + Intronic
1184833296 22:47004838-47004860 GTGTGTATGTACAGTAGTGTGGG - Intronic
1184918087 22:47587022-47587044 GTGATTAAGTACACAAATCAGGG - Intergenic
950030688 3:9851099-9851121 GTGTGTAAGTCCATTATTCAAGG - Intronic
951212505 3:19991137-19991159 GTGTTTAGGAACAATAATCTTGG + Intronic
955737214 3:62052280-62052302 TTGTGTTAGTACAGTAATCCAGG + Intronic
956005283 3:64772050-64772072 GTGTGCAGATATACTAATCTGGG + Intergenic
957762520 3:84576612-84576634 ATATTTAAGTACACTAATGTTGG - Intergenic
960039367 3:113134007-113134029 GTGTGTAAGTCAACTGAACTTGG - Intergenic
961902862 3:130231257-130231279 GTGGGTATTTACACTTATCTTGG - Intergenic
964060628 3:152518035-152518057 GTGTGTATGTCCACAAATATAGG + Intergenic
964149339 3:153505839-153505861 CTGTGAAAGAACACTAGTCTGGG + Intergenic
964770165 3:160216345-160216367 GAGTGTACTTACACAAATCTAGG + Intergenic
970228275 4:13882173-13882195 CTGTGTAAGCACACTATTCCAGG - Intergenic
970512029 4:16790540-16790562 GAGTGTACGTACACAAACCTAGG - Intronic
976165423 4:82249303-82249325 GTGTGTGAGTATATTTATCTTGG - Intergenic
978073195 4:104495409-104495431 GTGTGTAAATAAACTTGTCTGGG + Intergenic
978098713 4:104810955-104810977 TTGTGTATGTGCACTCATCTCGG + Intergenic
978229358 4:106379798-106379820 GAGTGTACTTACACAAATCTAGG - Intergenic
979555158 4:122037900-122037922 TTGTGTAAGTTCACTCATTTTGG - Intergenic
982644274 4:158003636-158003658 CTGTATAAGTACACTATTTTAGG - Intergenic
988681480 5:33488559-33488581 TTGTGTAAGTACAGTGATCAAGG - Intergenic
990618216 5:57529951-57529973 GTCTGTGTGTACACTAATGTTGG - Intergenic
990738081 5:58886066-58886088 GTTTGAAAGTACACTCATTTGGG - Intergenic
993115393 5:83714566-83714588 GTATGTAAGTACAGTAAAATTGG - Intronic
996297633 5:121941537-121941559 TTGTGTAAGTAACCTAATTTTGG + Intergenic
998443722 5:142182517-142182539 GTGTGAAAATAGACTAATATAGG + Intergenic
1000489619 5:161894801-161894823 TTGTGTAAGTAAACTAAAATGGG + Intronic
1001536419 5:172501365-172501387 GTGTGTAAGAACACACAGCTAGG + Intergenic
1003676919 6:8213303-8213325 GAGTGTACTTACACAAATCTAGG + Intergenic
1003753664 6:9091490-9091512 GAGTGTAAGTAGCCCAATCTTGG - Intergenic
1007980245 6:46147386-46147408 GTGTGTGAGTACACTAGTGGAGG - Intergenic
1010038018 6:71348192-71348214 GTTTGTCAGCACAATAATCTGGG - Intergenic
1014965630 6:127744816-127744838 GTGTGTAAGTACACTTGACATGG - Intronic
1021063350 7:16141896-16141918 GTGTGTGAGGACAATGATCTGGG - Intronic
1024226831 7:47331911-47331933 TTGAGGAGGTACACTAATCTGGG + Intronic
1024846496 7:53649825-53649847 GTGGGTAAGGACACCAGTCTGGG - Intergenic
1028527084 7:91798391-91798413 GTGTGTATTTACACTACGCTAGG + Intronic
1031158566 7:118139242-118139264 GTGTATAAGTACACAGATTTTGG + Intergenic
1031226496 7:119045219-119045241 GAGTGTACTTACACAAATCTAGG + Intergenic
1031892015 7:127305534-127305556 GTGTGTACCTACACAAACCTAGG - Intergenic
1037828130 8:22172013-22172035 GTCTGTAGGAACACTAACCTTGG + Intronic
1038612473 8:29069161-29069183 GTGTGGAAGGCCACCAATCTAGG - Exonic
1041930930 8:63285517-63285539 GTGTGTCAGTAGATAAATCTAGG - Intergenic
1043946951 8:86264317-86264339 GAGTGTACTTACACAAATCTAGG + Intronic
1044446459 8:92282574-92282596 GTGTGTAAGTAAAATTTTCTTGG + Intergenic
1046029430 8:108765806-108765828 GTATGTAAGTATAATAATTTAGG - Intronic
1048089858 8:131227701-131227723 GAGTGTACTTACACAAATCTAGG + Intergenic
1049262010 8:141644647-141644669 TTGTGTAATTACACGAATGTTGG + Intergenic
1052659896 9:31415650-31415672 GTGTGTGCGTACCTTAATCTAGG + Intergenic
1057594774 9:96406164-96406186 GTGTGAAAGTTCACTTAACTGGG - Intronic
1059476240 9:114550273-114550295 GATTGTAAGTACACTGTTCTTGG + Intergenic
1061998668 9:134204656-134204678 ATGCGTAAGTACAGAAATCTAGG - Intergenic
1186071992 X:5831607-5831629 GAGTGTACTTACACAAATCTAGG - Intergenic
1187955968 X:24519315-24519337 GTGTTTAACTTCACTAATCAAGG + Intronic
1188595260 X:31892580-31892602 GTGTGTACCTACACAAACCTAGG + Intronic
1188655653 X:32692144-32692166 GTGTGTAAGAACACTTAACATGG - Intronic
1190201992 X:48369726-48369748 GTGTGTAAATAAATTAATCTAGG - Intergenic
1190208546 X:48425687-48425709 GTGTGTAAATAAATTAATCTAGG + Intergenic
1190668840 X:52720336-52720358 GTGTGTAAATAAATTAATCTAGG - Intergenic
1190670577 X:52738068-52738090 GTGTGTAAATAAATTAATCTAGG + Intergenic
1192113111 X:68385116-68385138 GGGAGAAAGGACACTAATCTAGG + Intronic
1195675048 X:107501695-107501717 GTGCGTATGTACACTTTTCTGGG + Intergenic
1201523863 Y:14908801-14908823 GAGTGTACTTACACAAATCTAGG + Intergenic
1201666326 Y:16460429-16460451 TTGAATAATTACACTAATCTAGG - Intergenic