ID: 901866515

View in Genome Browser
Species Human (GRCh38)
Location 1:12110162-12110184
Sequence CCCGACTCTCCCTCCTCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901866506_901866515 18 Left 901866506 1:12110121-12110143 CCCGCCTCGCCCAGGAAGCTGCT 0: 1
1: 1
2: 2
3: 45
4: 345
Right 901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 203
901866507_901866515 17 Left 901866507 1:12110122-12110144 CCGCCTCGCCCAGGAAGCTGCTT 0: 1
1: 0
2: 1
3: 28
4: 379
Right 901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 203
901866508_901866515 14 Left 901866508 1:12110125-12110147 CCTCGCCCAGGAAGCTGCTTCTA 0: 1
1: 0
2: 1
3: 14
4: 188
Right 901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 203
901866509_901866515 9 Left 901866509 1:12110130-12110152 CCCAGGAAGCTGCTTCTAAACTG 0: 1
1: 0
2: 2
3: 10
4: 169
Right 901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 203
901866510_901866515 8 Left 901866510 1:12110131-12110153 CCAGGAAGCTGCTTCTAAACTGA 0: 1
1: 0
2: 1
3: 10
4: 167
Right 901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901866515 Original CRISPR CCCGACTCTCCCTCCTCTGT GGG Exonic
900176770 1:1294613-1294635 TCCGACTCTGCACCCTCTGTGGG + Exonic
900422928 1:2563399-2563421 CCCACCTCTCCCTCCACTGGAGG - Exonic
900513390 1:3070512-3070534 CCCGCCGCCCCCTCCTCTGCAGG + Intronic
901047377 1:6405319-6405341 CCCAAATCTCCCTCATCTGGTGG - Intergenic
901443658 1:9293645-9293667 TCCGGCTCTCCCTCCGCTGCTGG - Intronic
901468808 1:9441366-9441388 CCCCACTTTCCCACATCTGTTGG - Intergenic
901866515 1:12110162-12110184 CCCGACTCTCCCTCCTCTGTGGG + Exonic
902697072 1:18147259-18147281 CCTTACTCTCCTTCCTCTGGTGG + Intronic
903185472 1:21626526-21626548 CCCTCCTCTCCCTCCTCTTGGGG - Intronic
905983822 1:42257625-42257647 CCTGCCTCACCCTCCCCTGTAGG - Intronic
906170821 1:43723402-43723424 CCCGGCCTTCCCTCCTCTCTTGG + Intronic
906238931 1:44229648-44229670 CCCGGCACTCCCTCCCTTGTGGG + Intronic
906539717 1:46575984-46576006 CCCCTCTCTCCCTCCACGGTAGG - Intronic
907812792 1:57888901-57888923 TCCTACACTCACTCCTCTGTGGG + Intronic
908318746 1:62960632-62960654 CCCCACTCTCCAACTTCTGTTGG - Intergenic
911051548 1:93675772-93675794 CCCGACACTCTCTCCTATCTAGG + Intronic
912754676 1:112314269-112314291 CCCCACTCTCCCTACTTTTTAGG + Intergenic
915301289 1:154953052-154953074 CCCCCTTCTCCCTCCTCAGTGGG + Intronic
920175526 1:204099058-204099080 CCCCACTGTCCCACCTCTGCTGG - Intronic
922818795 1:228470362-228470384 CCCGGCTCTCCCTTCCCTGGTGG - Intergenic
1063961512 10:11309914-11309936 CCTGTCTCTCCCTGCTCTGGAGG + Intronic
1067728169 10:48789362-48789384 CCTGACTCCCCATCCTCTGGGGG - Intronic
1071494501 10:86158495-86158517 CCAAACTCTCTCTGCTCTGTAGG + Intronic
1072556461 10:96518311-96518333 ACCGACTGTCCATGCTCTGTGGG + Exonic
1072925449 10:99612938-99612960 CCCGTATCTCCCTCCACTGGTGG - Intronic
1074101195 10:110356078-110356100 CCAGAGTCTCCCTGCTCTCTTGG - Intergenic
1075622610 10:123939010-123939032 CACCCCTCTCCCTCCTCTGGAGG + Intronic
1075654723 10:124153306-124153328 CCAGCCTCTCCTTCCTCTGCTGG - Intergenic
1076522079 10:131087703-131087725 CCCGGCACCCCCTGCTCTGTGGG - Intergenic
1077306219 11:1869782-1869804 CCCCACGCCCCCTCCTCTGTGGG - Intronic
1077307315 11:1874100-1874122 CCCCAGCCTCCCTCCTCTGCCGG - Intronic
1077653672 11:3997783-3997805 CAAGACCCTCCCTCCTCTATGGG - Intronic
1079341617 11:19616501-19616523 CCCAACTCTCCCTGCTCCGCGGG - Intronic
1080104135 11:28494207-28494229 GCCTTCTCTCCCTGCTCTGTGGG - Intergenic
1081435799 11:43026360-43026382 TCCAAATCTCCCTTCTCTGTAGG + Intergenic
1081437776 11:43046155-43046177 CCTGATTCTCACTCCTCTGGAGG - Intergenic
1081565095 11:44255788-44255810 TCCTACTCTCCCTCCACAGTGGG - Intergenic
1081919970 11:46765714-46765736 CCTGACTCAGCCTCCTCAGTAGG + Intronic
1083293254 11:61701385-61701407 CCCGCCTCTCCCTCTGCTCTAGG + Intronic
1083809806 11:65097167-65097189 CCCCATTCTCCCACCTGTGTTGG + Intronic
1084076488 11:66782102-66782124 CCAAACTCTATCTCCTCTGTGGG + Intronic
1084686269 11:70697774-70697796 CCGGACCCTCCCACCTCTGCAGG + Intronic
1084946486 11:72641645-72641667 CCCTTCCCTCCCTCCTGTGTTGG - Intronic
1085474725 11:76782758-76782780 CCGGGCTCTCTCTTCTCTGTGGG + Intronic
1089553004 11:119295613-119295635 CCCAACTCAGCCTCCTCAGTAGG - Intronic
1090407560 11:126486269-126486291 CCCCACTGTCCCTTCTCTGCTGG - Intronic
1091118260 11:133035182-133035204 CCCGGCACACCCTCCCCTGTCGG - Intronic
1091122227 11:133065853-133065875 CCCGAAGCTCCCTCCTCTCCCGG + Intronic
1092147724 12:6226267-6226289 CCAGGCTCCCCCTCCTCTGAAGG - Intronic
1092762112 12:11819588-11819610 CCCGCCAATCCATCCTCTGTGGG + Intronic
1094221204 12:27995571-27995593 TCTGTCTCTCCCTCCTCTATTGG + Intergenic
1095475577 12:42584081-42584103 TCCAAATCTGCCTCCTCTGTGGG - Intronic
1096848677 12:54421445-54421467 CCCCAATATCCCTCCTCTCTTGG + Intergenic
1103192669 12:119015504-119015526 CCCTACTTTCCTTCCTCTTTTGG + Intronic
1106870586 13:34014615-34014637 CCCTTCTCTATCTCCTCTGTGGG - Intergenic
1107690436 13:42947998-42948020 CCCAACTCCGCCACCTCTGTTGG - Intronic
1110646977 13:77898382-77898404 CCCAACTCTTCCTCCTCTCCAGG + Intronic
1113457476 13:110458749-110458771 CCCTCCTCTCCCTCCTCTGCAGG + Exonic
1117388627 14:55241529-55241551 CCTGCCTCACCCTCCCCTGTAGG - Intergenic
1121291567 14:92780007-92780029 TCCCTCTTTCCCTCCTCTGTGGG + Intergenic
1122227913 14:100290494-100290516 CCCGACTCCCCCTTGTCAGTGGG + Intergenic
1122314678 14:100818676-100818698 CCAGACTGTCCCACATCTGTGGG + Intergenic
1122749350 14:103921321-103921343 CCCGGCTTTCCCTTCTCTGAAGG - Intronic
1124372800 15:29113024-29113046 TCAGACTCTCCCTCCTCTCCAGG + Intronic
1125476490 15:40051172-40051194 CCCCTCCCTCCTTCCTCTGTTGG - Intergenic
1125716827 15:41824099-41824121 CCTTACTCTCCCCTCTCTGTTGG + Intronic
1125852205 15:42914577-42914599 CCCCACTCTCCCTCCAATATGGG - Intronic
1125953632 15:43775008-43775030 CTCGATTCTCCCTCCTCAGCTGG - Intronic
1129644683 15:77419690-77419712 CCCAACTTTCCTTCCTCTGGGGG + Intronic
1129713733 15:77834947-77834969 CTCAACTCTCCATCCTCAGTAGG + Intergenic
1129852122 15:78799306-78799328 CCCCACTCTCCCAGCTCTGGAGG - Intronic
1130250881 15:82299781-82299803 CCCCACTCTCCCAGCTCTGGAGG + Intergenic
1131325770 15:91442581-91442603 CCCTATTCTCCTGCCTCTGTAGG + Intergenic
1131649385 15:94382276-94382298 CCCGATTCTCCAGCCTTTGTAGG + Intronic
1131688688 15:94802364-94802386 TCAGACTCTCCCTCCTTGGTTGG + Intergenic
1132888798 16:2194387-2194409 CCCGACTCGCCCTGCCCTGAAGG - Intronic
1134854729 16:17508827-17508849 CCCTATTCTCCTGCCTCTGTTGG - Intergenic
1135191920 16:20361477-20361499 CCCGACTCCCTTTCCTCTTTAGG + Intronic
1135594095 16:23728137-23728159 CCCCACTCTCCCTTCTCCGTGGG - Intergenic
1137626931 16:49914920-49914942 CCCACCACTCCCTCCTCTGCTGG - Intergenic
1138552172 16:57753983-57754005 CCCAACTCACCGTCCTCTGGGGG - Exonic
1139196086 16:64920143-64920165 CCAGACTCTCTGTGCTCTGTGGG - Intergenic
1141530029 16:84639873-84639895 CCCTTCTCTCCCTCATCTGCAGG + Intergenic
1142747752 17:1968446-1968468 CCCCACTCCCCCTTCTCTATCGG + Intronic
1143988156 17:10933353-10933375 CCCCACTCTCTCTCTCCTGTTGG - Intergenic
1146513512 17:33470842-33470864 CCTGACTCTACTTCCCCTGTGGG + Intronic
1147134568 17:38427764-38427786 CTCGACTCCCCCTCCTCTCTGGG + Intergenic
1147716052 17:42509433-42509455 CCTGACTCTCGGTCCTCTCTAGG + Intronic
1150260698 17:63788014-63788036 CCAGCCTCACCCTCCTGTGTAGG + Intronic
1150299688 17:64037758-64037780 CCCTACTCTCCTGCCTCAGTTGG - Intergenic
1150460653 17:65347547-65347569 CGGGACTATCCCTCCTCTGAGGG - Intergenic
1150645469 17:66975057-66975079 CCCGACACCTCCACCTCTGTGGG - Intronic
1152130214 17:78471961-78471983 CCCCACCCTCCCTCCTATCTTGG + Intronic
1152617991 17:81346496-81346518 TTTGACTCTCCCTCCGCTGTCGG + Intergenic
1154491884 18:14928715-14928737 TCTGCCTCTCCCTCCTCTATTGG + Intergenic
1157385039 18:47253332-47253354 CCCTCCTCTGCCTCCTCTCTGGG + Intergenic
1158505523 18:58043959-58043981 GCCGACCCTCCCTCCTCTCCCGG - Intergenic
1159186692 18:64984102-64984124 CCAGACACTTCCTCCTCTCTGGG + Intergenic
1161730503 19:5957583-5957605 CCCTACTGTCCCTCTGCTGTTGG + Intronic
1161935365 19:7368598-7368620 CCCACCTCTGCCTCCTCTGAGGG + Intronic
1161966400 19:7551284-7551306 CCCACCTCTCCCTCCTATGCCGG - Intronic
1162077922 19:8200977-8200999 CCCGACTCAGCCTCCCCAGTAGG - Intronic
1162771982 19:12954526-12954548 GCCCACTCTCCCTCCCCTGCAGG - Exonic
1163131076 19:15273347-15273369 CCTCACTCTGCCTCCTCTGTTGG - Intronic
1163541308 19:17912461-17912483 CCCAAATCTCCCTCTTCTCTGGG + Intergenic
1163649034 19:18506320-18506342 CCCGGGTGTCCCTCCACTGTGGG - Intronic
1166966640 19:46533213-46533235 CCTGTCTCTCCCTCCTCCATTGG - Intronic
925736288 2:6966960-6966982 CCCGACTGACCTTCCTCTCTTGG + Intronic
927220327 2:20701783-20701805 CCTGACTCACATTCCTCTGTTGG - Intronic
927966863 2:27275769-27275791 CCCCACTGTCCCACCTCTGAGGG + Intronic
930204296 2:48572853-48572875 CCCTGCTCTCCCTGCTCTGAGGG + Intronic
931040480 2:58292746-58292768 ACACACTATCCCTCCTCTGTAGG + Intergenic
932220343 2:69994410-69994432 CCAGACTCTCACTGCTCCGTTGG - Intergenic
933992267 2:87642364-87642386 TCAGGCTCTCCCTCCTCTGTGGG - Intergenic
936301583 2:111308475-111308497 TCAGGCTCTCCCTCCTCTGTGGG + Intergenic
937304435 2:120862518-120862540 CCCGTCTCTCTGTCTTCTGTGGG + Intronic
942063430 2:172248538-172248560 GCCGAGTCTCCAGCCTCTGTGGG + Intergenic
942136358 2:172930101-172930123 CCAGACATTGCCTCCTCTGTGGG - Intronic
943669926 2:190649265-190649287 CCCGGCTCTCCCTCCTCTGGCGG - Exonic
948460666 2:238128571-238128593 CCCCACTGTCCCTCCTCTCAGGG + Intronic
1169288064 20:4326037-4326059 TCCGACTCTCCCTGCTCTGCTGG - Intergenic
1170878263 20:20271426-20271448 TCCGTCTCTCTCTCCCCTGTTGG + Intronic
1170878666 20:20274975-20274997 TCCTTCTCTCCCTCCTGTGTGGG + Intronic
1172838139 20:37886220-37886242 CCTGACCCTCCCACCTCTCTAGG - Intergenic
1175215025 20:57387690-57387712 ACTCACTCTCCCTCCTCTGCAGG + Intergenic
1175365391 20:58451184-58451206 CTCGACTCTCACTGCTTTGTAGG + Intergenic
1175700735 20:61135189-61135211 CGCAACTCTCCCTCTTCTGGGGG + Intergenic
1175844562 20:62051683-62051705 CCCCACAGTCCCTCCTCTGAGGG + Intronic
1175912709 20:62412449-62412471 CCACCCTCGCCCTCCTCTGTGGG + Intronic
1177175003 21:17693776-17693798 CCTGACACTCCCTTTTCTGTGGG - Intergenic
1178499080 21:33110798-33110820 CCAGACTGTCTCCCCTCTGTTGG - Intergenic
1179164595 21:38925660-38925682 CCTGGCTCTGCCTCCTCTGCTGG - Intergenic
1180155330 21:45974679-45974701 CCCTCCCCTCCCTCCTTTGTGGG - Intergenic
1181003125 22:19997302-19997324 AGCAACTGTCCCTCCTCTGTGGG + Intronic
1181098549 22:20522942-20522964 CCCGTCTCTCCCTCCTGTTTTGG + Intronic
1183325322 22:37188276-37188298 CTCCTCTCTCCCTCCTCTGCTGG - Exonic
1183619527 22:38964536-38964558 CCCGGCTCTGCCGCCACTGTGGG - Intronic
1183640327 22:39088837-39088859 CCCGGCTCTGCCACCACTGTGGG - Intergenic
1184855255 22:47142968-47142990 CCAGAGTCTGCCTCCTCTGAGGG - Intronic
1185179394 22:49350348-49350370 CCCACCTCTCCCTCCTCCCTGGG - Intergenic
1185320841 22:50199723-50199745 CCCGACTCTGTCTCTTCTGCTGG - Intergenic
1185346800 22:50313941-50313963 CCCCACCCTGGCTCCTCTGTGGG - Intronic
950912035 3:16605038-16605060 GCCGCCTCTCCCAACTCTGTGGG + Intronic
956596315 3:70971299-70971321 CCCTACTCTCCATCGCCTGTTGG - Intronic
963258795 3:143173326-143173348 CCTGTCTTTCCCTCCTCTTTTGG + Intergenic
963605626 3:147410041-147410063 CCCGATTTTCCCTCCTCGGCTGG + Exonic
964876580 3:161373904-161373926 CCCGCCTCAGCCTCCTGTGTAGG + Intergenic
965138587 3:164806597-164806619 ATCGACTCTCCCTCCTTTTTTGG - Intergenic
965601396 3:170457922-170457944 CCAGGCTTTCCCTCCTCTGTGGG + Intronic
966732545 3:183162831-183162853 CCCGCCCCTCCCTGCTCCGTAGG - Exonic
967726257 3:192865055-192865077 TCAGCCTCTCCCTTCTCTGTAGG - Intronic
969376853 4:6768682-6768704 CCCGAGCCTCCTTCCTCTTTTGG - Intergenic
975701969 4:77075608-77075630 CCCCTTTCTCCCTCCTCAGTTGG - Exonic
976536526 4:86223711-86223733 CCAGATGCTCCCTCCTCTGGTGG + Intronic
978287431 4:107095224-107095246 CCTGTCTCTCCCTACTCTCTGGG + Intronic
979289319 4:118962427-118962449 CCCAACTTTGCCTTCTCTGTAGG - Intronic
985604906 5:853300-853322 CCCGACTCGCTGTCCTCGGTGGG - Intronic
985604913 5:853330-853352 CCCGACTCGCTGTCCTCTGCGGG - Intronic
985605115 5:854132-854154 CCCGGCTCGCTGTCCTCTGTGGG - Intronic
985605191 5:854423-854445 CCCGGCTCTCTGTCCTCTGTAGG - Intronic
985605205 5:854487-854509 CCCGGCTCGCTGTCCTCTGTGGG - Intronic
985605280 5:854809-854831 CCCGGCTCGCTGTCCTCTGTGGG - Intronic
985605378 5:855164-855186 CCCGGCTCTCTGTTCTCTGTAGG - Intronic
985605392 5:855228-855250 CCCGGCTCGCTGTCCTCTGTGGG - Intronic
985605415 5:855325-855347 CCTGACTCGCTGTCCTCTGTGGG - Intronic
985605424 5:855358-855380 CCCGGCTCTCTGTCCTCTGTGGG - Intronic
985605536 5:855809-855831 CCCGGCTCACTGTCCTCTGTGGG - Intronic
985721921 5:1493985-1494007 CCTGCCTCTTCCTCCTCTGGGGG - Intronic
986676739 5:10192157-10192179 CCAGCTTCTCCCTCATCTGTTGG - Intergenic
987313284 5:16701018-16701040 CCCGACTACCGCTGCTCTGTGGG - Exonic
989447149 5:41543177-41543199 CCCGTCTTTCCCTCCTCTCTTGG - Intergenic
995758898 5:115544008-115544030 CCCGAGTCTCCTGCCTCTTTCGG - Intronic
995856815 5:116601168-116601190 CCCTCCTCTCCCTCCTCTGAGGG + Intergenic
997395157 5:133553863-133553885 CCAGGTTCTCCCTTCTCTGTAGG - Intronic
998456991 5:142281085-142281107 CCCATCTCTCCCTGCTCCGTTGG - Intergenic
999230268 5:150057592-150057614 CCCAACCCTCTCTCCTATGTAGG - Exonic
1001681563 5:173561573-173561595 CTCCACTCTCCCTCCCCTGTTGG - Intergenic
1001780972 5:174368851-174368873 CCCGAAGCCCCCTGCTCTGTTGG + Intergenic
1004039018 6:11956807-11956829 CCCCACCTTCCCTCCTCTATTGG + Intergenic
1004051519 6:12085289-12085311 CCACACTGTCCCTTCTCTGTGGG - Intronic
1005075289 6:21901116-21901138 CAGGACTTTCCCTTCTCTGTTGG - Intergenic
1006019165 6:31107313-31107335 CCAGACCAGCCCTCCTCTGTGGG + Intergenic
1006020894 6:31116926-31116948 CCCGACTCTCCCTGCAGTGGAGG - Exonic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1006521876 6:34575531-34575553 CCCCACTCTCCCTACTCAGCAGG - Intergenic
1008270150 6:49481913-49481935 CCTGAGCCTCCCTCCTCCGTGGG - Intronic
1008679638 6:53858359-53858381 CCAGACTCTCCCTGCCCTGGTGG + Intronic
1009983968 6:70760041-70760063 CCAGACTTTCCCTCCTGTATCGG + Intronic
1011908093 6:92398350-92398372 ACCTCCTCTCCCTCCTCTGCTGG - Intergenic
1013405766 6:109841524-109841546 CCTAACTCTCCAGCCTCTGTAGG - Intergenic
1014076271 6:117238835-117238857 CCCGAGTCTCCTTACTCTGTTGG - Intergenic
1017734865 6:157353365-157353387 CCAGATTCTCTCTCCTCTCTAGG + Intergenic
1018586519 6:165366645-165366667 CCAGACTCTCCCTTCTCAATGGG - Intronic
1020122567 7:5513381-5513403 CCCGTCTCTCCGTCCCCTGAGGG - Intronic
1023601582 7:41886314-41886336 CATGACGCTCCCTGCTCTGTGGG - Intergenic
1026834178 7:73627187-73627209 CCCCACTCTCCCTCCTTTGGAGG + Intergenic
1030075875 7:105736121-105736143 CCAGTCCCTCCCTCTTCTGTGGG + Intronic
1032305675 7:130731405-130731427 CCCATCTCTTCCTCCTCTCTGGG - Exonic
1032513644 7:132491467-132491489 TCTGACTGTCCCTACTCTGTAGG - Intronic
1035604329 8:919751-919773 CCCGCCTCTCTTTCCTCTGCAGG + Intergenic
1035725531 8:1823390-1823412 CCCGACGCCCCCTCCTCGGCTGG + Intergenic
1035914893 8:3608235-3608257 CCTGACACTACCTCCTCTGCAGG - Intronic
1039845235 8:41321291-41321313 CATGACTCTCCGTCCTCTGGAGG + Intergenic
1047970732 8:130082096-130082118 CCAGCCTCTCCCTCTTCAGTAGG - Intronic
1048001902 8:130385655-130385677 CCTGACTCTCCCTCCACTCGTGG - Intronic
1048821132 8:138381851-138381873 CCCGACACTGGCTTCTCTGTGGG - Intronic
1049235578 8:141510719-141510741 GCCTGCTCTCCCTCCTCCGTCGG + Intergenic
1049570633 8:143368840-143368862 CCCGACTGTCCCTCCTGAGTGGG - Intronic
1049986262 9:954544-954566 CCTGACCCTCCCTCATCTCTTGG - Intronic
1050398227 9:5222709-5222731 CCTGCCTCTCCCACCTCTGGAGG - Intergenic
1057262999 9:93596531-93596553 CCCGACTCCCAGTCCTCTGAAGG - Intronic
1057409702 9:94807162-94807184 CCAGGCTCTCTCTCTTCTGTTGG + Intronic
1057452657 9:95178499-95178521 CCGGTCTCTTCCTCCTCTGAGGG + Intronic
1058814749 9:108672708-108672730 CCACGCTCTCCGTCCTCTGTTGG - Intergenic
1059369675 9:113817263-113817285 CCTGAATGTCCCTGCTCTGTAGG + Intergenic
1059557735 9:115298294-115298316 CCAACCTCTCCCTCCACTGTAGG - Intronic
1060483734 9:124033892-124033914 TCCAACCCTCCCTCCTCTCTGGG - Intergenic
1061726704 9:132586018-132586040 CCAGGCTCTCCCTGCCCTGTGGG - Intronic
1062008879 9:134256484-134256506 CAAGACTCTCACTCCTCTTTGGG + Intergenic
1062559836 9:137136601-137136623 CCCGGCTCTACATCCTCTGCAGG - Intergenic
1062589444 9:137266814-137266836 ACCGACCCTCCCTCCTCTCCAGG - Intronic
1187390342 X:18882596-18882618 CCTGACTCTCCCTCCTTGGTTGG + Intergenic
1191870116 X:65738575-65738597 CCTCACTCTCCTTCTTCTGTCGG - Exonic
1197769551 X:130081539-130081561 CCCATCTCTCCCTTCTCTCTAGG - Exonic