ID: 901868748

View in Genome Browser
Species Human (GRCh38)
Location 1:12125311-12125333
Sequence GCCCAGGCCAGGCCAGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 11, 3: 120, 4: 806}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901868748_901868757 2 Left 901868748 1:12125311-12125333 CCCCGGCCTGGCCTGGCCTGGGC 0: 1
1: 0
2: 11
3: 120
4: 806
Right 901868757 1:12125336-12125358 GGGCTCTGCCACTTACTCTCAGG 0: 1
1: 2
2: 3
3: 48
4: 346
901868748_901868758 3 Left 901868748 1:12125311-12125333 CCCCGGCCTGGCCTGGCCTGGGC 0: 1
1: 0
2: 11
3: 120
4: 806
Right 901868758 1:12125337-12125359 GGCTCTGCCACTTACTCTCAGGG 0: 1
1: 2
2: 2
3: 50
4: 311
901868748_901868760 12 Left 901868748 1:12125311-12125333 CCCCGGCCTGGCCTGGCCTGGGC 0: 1
1: 0
2: 11
3: 120
4: 806
Right 901868760 1:12125346-12125368 ACTTACTCTCAGGGTGACCTTGG 0: 1
1: 0
2: 8
3: 80
4: 645
901868748_901868761 13 Left 901868748 1:12125311-12125333 CCCCGGCCTGGCCTGGCCTGGGC 0: 1
1: 0
2: 11
3: 120
4: 806
Right 901868761 1:12125347-12125369 CTTACTCTCAGGGTGACCTTGGG 0: 1
1: 0
2: 7
3: 104
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901868748 Original CRISPR GCCCAGGCCAGGCCAGGCCG GGG (reversed) Intronic
900130828 1:1086461-1086483 GCCTGGGCCAGGACAGGCCAGGG + Intronic
900290308 1:1920933-1920955 GCCAGGTCCAGGCCAGGCCCCGG - Intergenic
900290827 1:1922924-1922946 GCCCAGGGCAGGGGAGGCCGAGG + Intronic
900312661 1:2041688-2041710 CCCCAGGCCAGTCCACGCCCTGG + Intergenic
900394960 1:2449609-2449631 GCCCCACCCAGGCCAGGCAGAGG - Intronic
900474411 1:2869479-2869501 GCCCGTGCCAGGCCAGGCTCTGG - Intergenic
900596029 1:3480587-3480609 GCCCTGGCGAGGCCAGCCGGCGG + Exonic
900622052 1:3592029-3592051 GCTCAGGTCAGGCCAGGCCAGGG + Intronic
901070202 1:6513175-6513197 GCCCAGGCCCAGCCTGGCCCAGG + Intronic
901637732 1:10678127-10678149 GCCCAGCCCAGGAGAGGCGGCGG + Intronic
901642324 1:10699005-10699027 CCCCAACCCAGGCCAGGCCATGG - Intronic
901664984 1:10820761-10820783 CCCCAGCCCAGGCCAAGCTGCGG - Intergenic
901868748 1:12125311-12125333 GCCCAGGCCAGGCCAGGCCGGGG - Intronic
902323600 1:15684386-15684408 GCCCAGGCGAGGCGAGGGCCGGG + Exonic
902334738 1:15748396-15748418 ACCCAGCCCAGGCCAGCCTGAGG - Intergenic
902817847 1:18926324-18926346 GGAGAGGCCAGGCCAGGCCAGGG + Intronic
902817850 1:18926329-18926351 GGCCAGGCCAGGCCAGGGGGAGG + Intronic
902874279 1:19331629-19331651 GCACAGGCCAGGGCAAGCTGGGG - Intergenic
902896947 1:19485589-19485611 GCCCGGGCCGGGCCGGGGCGGGG - Intergenic
902956192 1:19925507-19925529 ACCCAGGCCAGGAGAGGCAGGGG - Intergenic
903233062 1:21933629-21933651 GCCCGGGCCAAGCCAGGCAGGGG + Intronic
903259402 1:22123212-22123234 GACCACGCGAGGCCAGGCTGAGG - Intronic
903345882 1:22684117-22684139 GGCAAGGCCAGACCAGGCCAAGG + Intergenic
903398328 1:23019733-23019755 GCCCAGCCGAGGTCGGGCCGGGG + Exonic
903443587 1:23406457-23406479 GAGCAGGCCAGGCCAGGAAGTGG - Intronic
903543498 1:24109823-24109845 GTCCATTCAAGGCCAGGCCGTGG + Intronic
903889499 1:26560177-26560199 GCGCAAGCCAGGGCTGGCCGTGG + Intronic
903926457 1:26834055-26834077 GGCCAGCCCAGGTCAGACCGTGG - Intronic
903970913 1:27118247-27118269 GGCCGGGCCGGGCCAGGCTGAGG + Intronic
904011463 1:27392708-27392730 GACCAGGCGCGGCCGGGCCGCGG - Exonic
904043716 1:27598459-27598481 GGCCAGGAGAGGCCAGGCCTTGG + Intronic
904370928 1:30046934-30046956 GGCCAGGCCAGTCCTGCCCGTGG - Intergenic
904410521 1:30322208-30322230 GCCCAGGCCAGGCCAGCTCGGGG - Intergenic
904417400 1:30371755-30371777 GGCCAGGCCAGCCCTGGCGGTGG + Intergenic
904465359 1:30704455-30704477 ACCCAGGCCAGCCCAGGACAGGG + Intergenic
904592412 1:31622380-31622402 ACCCAGGCCATGCCGGGCAGCGG + Intronic
904599432 1:31665503-31665525 GGCCTGACCAGGCCAGGCTGGGG - Intronic
905201794 1:36321147-36321169 GCCCCAGCCAGGTCAGGCCGCGG - Exonic
905253751 1:36666539-36666561 GCCTAAGCCAGGCCAGGGGGAGG - Intergenic
905268056 1:36768666-36768688 GTCCAGGCCAAGCCTGGCTGGGG - Intergenic
905284463 1:36870245-36870267 GCTCAGGCCTGGCTAGGCCAGGG - Intronic
905285962 1:36880605-36880627 GGCCAGGCCTGGCTAGGCTGGGG - Intronic
905356696 1:37389828-37389850 GCCCAGGCCAACCCTGGCCCAGG - Intergenic
905653109 1:39669494-39669516 GCCCAGGCCAGGCCATGATGGGG + Intronic
905867172 1:41382625-41382647 GCCCCGGCCAGGCCCGGCGGCGG - Exonic
905881363 1:41466379-41466401 GTCAGGGCCAGGCCAGGCAGGGG + Intergenic
906153601 1:43601625-43601647 GCACAGGCCAGGACTGTCCGAGG + Intronic
906264434 1:44417783-44417805 GCCCCGGGGAGGCCAGGCCACGG + Intronic
906495679 1:46302680-46302702 GGCAAGGCCAGGCCAGGCCCGGG - Intronic
906526742 1:46497988-46498010 GCCCAGGCAGGGCCCGGCCTGGG + Intergenic
906537306 1:46558606-46558628 GCCCTGGCCCAGGCAGGCCGTGG - Exonic
906545503 1:46616863-46616885 GCCCCGGCCCCGCCACGCCGCGG + Intronic
907053651 1:51345607-51345629 CTGCAGGCCAGGCCAGGCCCTGG + Intergenic
907110913 1:51925503-51925525 GACCAGGCCATGCCAGGTCTTGG - Intronic
907238937 1:53070029-53070051 GCCCGGGCCTGGCCCAGCCGCGG + Exonic
908085318 1:60625804-60625826 GCCTCAGCCAGGCCAGGCCAGGG - Intergenic
908445636 1:64196773-64196795 GCTCAGGCAGGGCCAGGCCCTGG + Intergenic
911104413 1:94118680-94118702 GCCCAGACCAGGCCCAGCCCTGG + Intronic
911975294 1:104487360-104487382 GCCCACCCCAGGACAGGCCCTGG + Intergenic
912454180 1:109786877-109786899 TCCCAGGCCAGCCCAGACCCAGG - Intergenic
912637564 1:111312228-111312250 GCCCAGTACCGGCCAGGCCTGGG + Exonic
912775129 1:112502087-112502109 GCTCAGGCCAGGCCTGGCCAGGG - Intronic
913053040 1:115133641-115133663 GCCCAGGCCAGGCAGGTCCTGGG - Intergenic
913957405 1:143318480-143318502 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
914051719 1:144143844-144143866 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
914127478 1:144822697-144822719 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
914857878 1:151365400-151365422 GCCCAGGACTGTCCAGGCCAGGG - Intronic
915079494 1:153342053-153342075 GCACCCGCCAGGCCAGGCCAGGG + Intronic
915094059 1:153446674-153446696 GCCCAGCCCAGCCCAGCCCATGG + Intergenic
915510649 1:156385174-156385196 GCCCAAGCCAGGCCTGGTTGAGG + Exonic
915523353 1:156461600-156461622 GTACAGGCCAGGCCAGTCTGAGG + Intergenic
915544925 1:156591762-156591784 GCCGGGGCCGGGCCGGGCCGGGG + Exonic
915905393 1:159873211-159873233 GCCCAGGCCAGGAAAGGTGGTGG + Intronic
915916067 1:159941748-159941770 TCCCAGGCCTGGGCAGGCGGAGG + Intronic
916058428 1:161083496-161083518 GGCCAGGCCAGGCCAAGCCCAGG + Intronic
916483400 1:165235658-165235680 GCGGAGGCGAGGCCAGGTCGCGG - Intronic
916497189 1:165356533-165356555 GCCCAGGCTGGGCCGGGACGTGG + Exonic
917348921 1:174056787-174056809 GCTCAGGCCAGCCCAGGAAGAGG + Intergenic
917920280 1:179744404-179744426 ACCCAGGCCAGGCCGGGTGGCGG - Intronic
918070157 1:181128682-181128704 CCCCAGGGCAGGCCGGGCAGGGG + Intergenic
919578094 1:199336995-199337017 GCTCAGGTCAGACCAGGCCAGGG - Intergenic
920088556 1:203435721-203435743 TTCCAGGCCAGGCCAGCCTGGGG - Intergenic
920341532 1:205278189-205278211 GGCCTGGCCTGGCCAGGCCAAGG + Intergenic
920377522 1:205517112-205517134 GAGCAGGCCAGGCCAGCCCCAGG - Intronic
920630369 1:207645819-207645841 GCCCAGGCCAGCCCAGCCCATGG - Intronic
920674460 1:208029538-208029560 AGCCAGGCCAGGCCAGCCCTGGG - Intronic
922071281 1:222196383-222196405 GCTCAGGGCAGGCCTGGCTGTGG - Intergenic
922572027 1:226639960-226639982 ACCCAGGACAGGCCAGCCCCGGG - Intronic
922729427 1:227942107-227942129 TCCCAGGCCAGGGCAGGCACTGG + Intronic
922801619 1:228367212-228367234 GGGCAGGCAGGGCCAGGCCGGGG + Intronic
923543661 1:234908494-234908516 GCCCAGGCTAGGCAGGGCCCTGG + Intergenic
924953393 1:248906166-248906188 CCCCGGGCCAGGCCACGCCCCGG - Intergenic
1063454623 10:6174480-6174502 GCCCAGGTCAGCCCGGGCCACGG - Intronic
1063465653 10:6242385-6242407 GCCCAGGACGGGCCTGGCCAGGG + Intergenic
1063664194 10:8051822-8051844 GTCCGGGCCAGGCCAGGCGCCGG - Intergenic
1065801658 10:29357949-29357971 GCTAAGGCCAGGGCAGGCAGGGG + Intergenic
1066760253 10:38742092-38742114 GCCGAGGCCAGGGCAGGGCAAGG - Intergenic
1067017329 10:42768047-42768069 GGCCAGCCCAGGACAGGCGGTGG + Intergenic
1067048645 10:42999868-42999890 GCCCAGGCCAGGGCAGTCCCTGG + Intergenic
1067205220 10:44207044-44207066 GCCCAGGCCTGGGCAGACTGCGG - Intergenic
1067344807 10:45429314-45429336 GCCCAGTCCAGTCCTGGCCTTGG - Intronic
1067525151 10:47034022-47034044 GCCCAGCTCGGGCCAGGCCATGG + Intergenic
1067564420 10:47326425-47326447 GTTGAGGCCAGGCCAGGCTGAGG + Intergenic
1067718173 10:48705373-48705395 TCCCAGGCGAGGCCAGGGTGAGG - Intronic
1067839322 10:49663463-49663485 GCCCTGTCCATGCCAGGCCCTGG - Intronic
1067945665 10:50686666-50686688 GCCCAGGCCAAGAGGGGCCGAGG + Intergenic
1069660876 10:70122663-70122685 GCCGAGGGCTGGCCAGGCCTGGG + Intronic
1069660877 10:70122664-70122686 TCCCAGGCCTGGCCAGCCCTCGG - Intronic
1069719289 10:70539484-70539506 GCCAGGGCCAGGCCTGGCCATGG + Intronic
1069719290 10:70539485-70539507 GCCATGGCCAGGCCTGGCCCTGG - Intronic
1070281097 10:75049478-75049500 GAGAAGGCCAGGCCAGGCCAGGG + Intronic
1070309473 10:75262862-75262884 TCCCTGGCCAGGGCAGGCTGAGG - Intergenic
1070398400 10:76032303-76032325 GCCCAGGCCAGGCCAGTGGCTGG - Intronic
1070780722 10:79136064-79136086 GCCAAGGCCAGGCCTGGGGGAGG - Intronic
1070781999 10:79143104-79143126 GCCCCCTCCAGGCCAGGCCCCGG + Intronic
1070844773 10:79513175-79513197 GCCAGAGCCAGGCCAGGCTGGGG - Exonic
1070867178 10:79713539-79713561 GCCCAGGCCAAGAGGGGCCGAGG + Intronic
1070880970 10:79851663-79851685 GCCCAGGCCAAGAGGGGCCGAGG + Intergenic
1070929031 10:80247136-80247158 GCCAGAGCCAGGCCAGGCTGGGG + Intergenic
1070954155 10:80453949-80453971 GCGCAGGCCGGGCCTGGCCCGGG - Intergenic
1071567989 10:86681410-86681432 GCACAGGGCAGGCCATGCAGGGG - Intronic
1071634093 10:87235763-87235785 GCCCAGGCCAAGAGGGGCCGAGG + Intronic
1071647541 10:87367980-87368002 GCCCAGGCCAAGAGGGGCCGAGG + Intronic
1072152131 10:92691634-92691656 CCCCAGGCCCGGCCCGGCTGAGG - Intronic
1072617658 10:97060191-97060213 GCCCAGGTCAGCCCAGCCCTGGG + Intronic
1072899381 10:99393869-99393891 CCTCAGGCCAGGCCAGGCAAGGG - Exonic
1073112357 10:101070185-101070207 ACCTAAGCCAGGCCAGGCCCTGG - Intergenic
1073242199 10:102066091-102066113 GGCCACGCCAGGCCAGGTGGTGG - Exonic
1073456167 10:103637990-103638012 GACCAGGGGAGGCCTGGCCGAGG - Intronic
1074832217 10:117256859-117256881 GCCCAAGACAGGACAGGCCCAGG - Intronic
1075545151 10:123349798-123349820 GCCCAGGCCATGCCATGCACAGG + Intergenic
1075552067 10:123400154-123400176 GGAAAGGCCAGGCCAGGCAGAGG - Intergenic
1075558356 10:123449451-123449473 CCACATGGCAGGCCAGGCCGAGG + Intergenic
1075585163 10:123652033-123652055 AGCCAGGCCATGCCAGGCTGAGG - Intergenic
1075707783 10:124512170-124512192 GCCAGTGCCAGGCCAGGCAGTGG - Intronic
1075729059 10:124625585-124625607 GCCCAGGCCTGGCCAGGGGCAGG - Intronic
1075872009 10:125777963-125777985 GGCCAGGCGAGGCCAGGCCACGG - Intergenic
1076047588 10:127307265-127307287 GATGAGGCCAGCCCAGGCCGGGG - Intronic
1076132418 10:128022478-128022500 GCACGGGGCAGGCCAGGCCCTGG - Intronic
1076216287 10:128696201-128696223 GCCCAGGCCAGCCCAGCCACAGG + Intergenic
1076475129 10:130746457-130746479 TCCAAGGCAAGGCCAGGCTGTGG - Intergenic
1076600537 10:131654458-131654480 GGCCAGCCCATGCCAGGCTGGGG - Intergenic
1076715068 10:132359526-132359548 GCCCAGCCCAGCCCAGCCCGTGG - Intronic
1076793905 10:132789677-132789699 GGCCAGGCTAGGCCAGGATGAGG - Intergenic
1076796279 10:132799893-132799915 GCCCAGCCCTGGCCAGCCTGTGG + Intergenic
1076864540 10:133160414-133160436 GCCCAGCCCAGCCCAGCCGGAGG + Intergenic
1076993042 11:285463-285485 GCCCCGTCCAGGACAGGCCCAGG + Intergenic
1077030103 11:461671-461693 GCACTGGCCAGGCCAGGCCTGGG - Intronic
1077119104 11:898681-898703 GTCCAGTCCAGGCCAGGTGGGGG + Intronic
1077199802 11:1300706-1300728 GCCCAGCTCAGCCCAGGACGTGG + Intronic
1077214441 11:1389523-1389545 GGCGAGGCGAGGCCAGGGCGAGG - Intergenic
1077233615 11:1469555-1469577 CCTCAGGCAAGGCCAGGACGGGG - Intronic
1077321201 11:1942879-1942901 GCCCAGGGGAGGCCAGACCCAGG - Intergenic
1077388246 11:2285844-2285866 GCCCAGCCAGGGCCAGGCCCTGG - Intergenic
1077491321 11:2862306-2862328 GGCCGGGCCAGGACAGGCTGTGG - Intergenic
1077547871 11:3183702-3183724 GGCCCGGCCTGGCCCGGCCGTGG - Intergenic
1078096228 11:8298930-8298952 GGCAAGGCCAGCCCAGGCGGTGG - Intergenic
1079242126 11:18728704-18728726 GGACATGCCAGGCCAGGCCTGGG - Exonic
1080297420 11:30746254-30746276 GCCCAGGAGAGACAAGGCCGTGG - Intergenic
1082004147 11:47410416-47410438 GCCCAGGGCTGGCCAGGGTGTGG + Intronic
1082004534 11:47412297-47412319 GGCCAGGCCAAGCCAAGCCAGGG - Intronic
1082789070 11:57335127-57335149 GCCCAGGCCACCACAGGCAGGGG - Exonic
1082897925 11:58212913-58212935 GCCCAAACCAGCCCAGGCCTTGG + Intergenic
1083165863 11:60887043-60887065 GCCCACCCCAGGACAGGCCCTGG - Intergenic
1083188884 11:61035419-61035441 GCCCAGCCCAGCCTAGGCCCCGG - Intergenic
1083303355 11:61750155-61750177 GCACAAGCCAGGCCACCCCGTGG - Intergenic
1083321776 11:61852110-61852132 GCCCAGCCCAGGCCAAGCCCGGG - Intronic
1083340634 11:61956326-61956348 GACCAGGTCAGGCCAGGCTGAGG - Intronic
1083402505 11:62433693-62433715 GCTCCAGCCAGGCCAGACCGAGG - Intronic
1083739466 11:64701044-64701066 GCACCGCCCAGGCCAGGCCCTGG + Intronic
1083739468 11:64701049-64701071 GCCCAGGCCAGGCCCTGGTGAGG + Intronic
1083797740 11:65027437-65027459 GCGCAGGCCTGGCGAGGCGGCGG + Exonic
1083802084 11:65052704-65052726 GGCAGGGCCAGGCCAGGCTGAGG - Intronic
1083842029 11:65310071-65310093 GTCCAGGACAGTCCAGGCCCTGG + Intergenic
1083899909 11:65638547-65638569 TCCCAGGCCAGGCCAGGGACTGG - Intronic
1084166990 11:67379686-67379708 GCCCTGGCCAGCCCATGCCGCGG + Intronic
1084169900 11:67396061-67396083 GCCCAGCTCAGCCCAGCCCGGGG + Intronic
1084538814 11:69774407-69774429 CCCCAGCCTGGGCCAGGCCGGGG + Intronic
1084548203 11:69825048-69825070 GGCCGGGCCAGGCCAGGACTTGG - Intergenic
1084660767 11:70545064-70545086 GCCCAGGCCAGGGCAGGCAAGGG + Intronic
1084674005 11:70623905-70623927 TCCCAGGCCAGGGCAGGGTGTGG + Intronic
1084892622 11:72244027-72244049 GGCCGGGCCAGGCCGGGTCGGGG + Exonic
1084961858 11:72721071-72721093 TGCCAGGCCAGGCCAGGCCTGGG - Intronic
1084968385 11:72756192-72756214 TTCCAGGTCAGGCCAGGCTGGGG - Intronic
1085020694 11:73205039-73205061 GCCCAGGCCAGGGCAGGAGCAGG - Intergenic
1085044370 11:73344561-73344583 GGCCAGGCCAGGCGCGGCCCTGG - Intronic
1085318173 11:75558532-75558554 GCCCAGCACAGGCCTGGCAGCGG + Intergenic
1085472638 11:76768007-76768029 GTCCAGGCCTGGCCTGGCCAGGG - Intergenic
1085524849 11:77158159-77158181 TGACAGGCCAGGCCAGCCCGGGG - Intronic
1086351941 11:85951160-85951182 GCCTAGGCTAGGCCATGCTGAGG - Intergenic
1088773928 11:113063365-113063387 TGCCAGGCCAGGCTAGGCAGTGG - Intronic
1089175750 11:116547761-116547783 TGTCAGGCCAGGCCAGGCCAGGG - Intergenic
1089299655 11:117490901-117490923 GGCCAGTCCAGGGCAGGCTGGGG + Intronic
1089635059 11:119806759-119806781 GTCCTGGGCAGGCCAGGGCGGGG + Intergenic
1089772707 11:120815024-120815046 CTGCAGGCCAGGCCAGGCCGTGG + Intronic
1089862718 11:121604337-121604359 GCCCAGCCCAGCCCAGCCCGTGG - Intronic
1090240253 11:125176640-125176662 GGTCAGGCCAGGCCAGCCCAAGG - Intronic
1090406161 11:126476795-126476817 GGCCAGGCTGGGCCAGGCAGTGG + Intronic
1091037219 11:132245127-132245149 GCCCCTGCCAGGCCTGGCAGAGG + Intronic
1091288034 11:134419673-134419695 GGCCACACCAGGCCAGGCCTAGG - Intergenic
1091304260 11:134527463-134527485 GCCCAGGCGAGCCCAGGGCTCGG + Intergenic
1091543261 12:1482118-1482140 GCCCATGTCTGGCCAGCCCGGGG + Intronic
1091770913 12:3150783-3150805 CCCAAGGCCAGGCCAGGCGTGGG - Intronic
1091857694 12:3752820-3752842 GCAAGGGCCAGGCCAGGCCTGGG + Intronic
1091857697 12:3752825-3752847 GGCCAGGCCAGGCCTGGGGGTGG + Intronic
1092209289 12:6635946-6635968 GCCCAGCCCAGAGCAGGCAGCGG - Exonic
1092366492 12:7881220-7881242 GCCTAGGCCAGCCCAGGAAGGGG - Intronic
1092839670 12:12527972-12527994 GCACAGGCCAGCCCAGGCAGAGG + Intronic
1094058369 12:26288312-26288334 GCCAAGGCCAGACAAGGCCAGGG + Intronic
1096116954 12:49060403-49060425 GACCAGAGCCGGCCAGGCCGGGG - Intergenic
1096145065 12:49273031-49273053 GTCCAGGCGAGCCCAGGCCTCGG - Exonic
1096258829 12:50078567-50078589 GCACATGCCAGGTCAGGCCTGGG + Exonic
1096296931 12:50391928-50391950 GCCCATGCCATGCCATGCCATGG + Intronic
1096608956 12:52788620-52788642 AGTCAGGCCAGGCCAGGCCAGGG - Intergenic
1096800420 12:54106884-54106906 TCGCGGGCCAGGCCAGGCGGAGG - Intergenic
1097184891 12:57191234-57191256 TCAGAGGCCAGGCCAGGCTGTGG + Intronic
1097234158 12:57528348-57528370 GGTGAGGCCAGGCCAGCCCGGGG + Exonic
1100404954 12:94264502-94264524 GGCCAGGCCAGGCCCGGCCCGGG - Intronic
1102256557 12:111418660-111418682 GGCCAGGCCAGGCCGGGCGGGGG - Exonic
1102349277 12:112180136-112180158 GCCTAGGCCAGGCCCAGCTGTGG + Intronic
1102570745 12:113825604-113825626 CCCCAGGCCAGGCCTGGCCCAGG - Intronic
1102571330 12:113828705-113828727 TCCCAAGCCAGGCCAGCCCCCGG - Intronic
1103721597 12:122978382-122978404 GCCCAGGCCTGGCCGGCCCACGG + Intronic
1103723130 12:122985301-122985323 GGCCAGGCCCGTCCAGCCCGTGG + Exonic
1103920595 12:124397226-124397248 CCCCAGGCCAGGCACGGCCGAGG + Intronic
1104854765 12:131896400-131896422 GCCCAGGGCAGGCAGGGCTGGGG + Intronic
1104910618 12:132238519-132238541 GCCCAGGACAGGCCAGAGGGCGG + Intronic
1105210080 13:18252538-18252560 GGCCAGGTGAGGCCAGGTCGGGG - Intergenic
1105408639 13:20151571-20151593 GCACAGGCCAGAGCAGACCGGGG + Intronic
1105579082 13:21676823-21676845 TCCAAGGCCAGGCAAGGCAGTGG - Intronic
1105680123 13:22717582-22717604 GCCAGAGCCAGGCCAGGCCATGG - Intergenic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1105883432 13:24623297-24623319 GCCTAGGCCAGGCCAGAGAGGGG - Intergenic
1106409307 13:29499940-29499962 TCCCAGCTCAGGCCAGGCCTAGG + Intronic
1106687349 13:32074890-32074912 GCCCAGACCAAGCCAGGTGGAGG + Intronic
1107726622 13:43305954-43305976 GCGCAGGCCAGGCTGGGCAGGGG - Intronic
1107793042 13:44021791-44021813 GCCAAGGCCCTGCCAGGCCTTGG - Intergenic
1108396582 13:49996785-49996807 GCCAAGGCGAGGCGCGGCCGGGG + Intronic
1113451682 13:110414445-110414467 GGCCAGCCCAGGCCAGTCCTGGG + Intronic
1113670264 13:112171238-112171260 GGACAGGCCAGGCCAGGCCAGGG + Intergenic
1113696324 13:112348733-112348755 GCTCATGCCAGGCTAGGCGGGGG - Intergenic
1113839305 13:113349751-113349773 GCCCAGGGCTGTCCAGGCAGGGG + Intronic
1113855909 13:113445415-113445437 GGCCATGCCAGGACAGGCTGTGG + Intronic
1114454675 14:22847019-22847041 GGCCAGGCCAAGCCAAGCAGGGG + Exonic
1115851667 14:37594732-37594754 GCCCGGCCAAGGCCCGGCCGGGG + Intronic
1119223306 14:72926278-72926300 GCCCCAGACAGGCCAGGCCTGGG + Intergenic
1119379881 14:74221776-74221798 TCCCAGACCAGCCCAGGCTGTGG + Intergenic
1119443131 14:74642287-74642309 GGCCGGGCCAGGCCAGGCTGGGG - Intergenic
1119539269 14:75428124-75428146 GCCCAGGCCTGTCCCGGCCCGGG - Intronic
1119703043 14:76768207-76768229 GGGGAGGCCAGGCCAGGCCCTGG + Intronic
1119758116 14:77133000-77133022 GCCCAGCCCAGTCCAGGACCTGG - Exonic
1120186183 14:81395974-81395996 GCCGAGGCCAGGTCAGGTGGGGG + Exonic
1120780076 14:88479206-88479228 TCCTGGGCCAGGCCGGGCCGAGG + Exonic
1120789158 14:88563260-88563282 GTCCAGCGGAGGCCAGGCCGCGG - Intronic
1121022393 14:90588226-90588248 GGCCAGGCCAGGCCAGGCCAGGG + Intronic
1121452028 14:94014820-94014842 GCCCAGGCCTGGCCATCCAGAGG - Intergenic
1121569501 14:94936829-94936851 GCCAAGGCCAGGCCGGGCCGAGG - Intergenic
1121595125 14:95156898-95156920 CCCCAGGCCTCGCCAGGCCGGGG + Intronic
1121986695 14:98513785-98513807 ACCCAGGCCAAGTCAGGCAGAGG + Intergenic
1122145145 14:99684388-99684410 GGGCAGGGCAGGCCAGGCCAGGG - Exonic
1122290473 14:100678066-100678088 GCGGAGGCCTGGCCAGGCAGAGG - Intergenic
1122296597 14:100709423-100709445 GGCCAGGCCAGGGGAGGCCTGGG - Intergenic
1122415422 14:101547382-101547404 GCCAAAGCCAGGCCATGCCCAGG + Intergenic
1122514473 14:102297601-102297623 GCCCCGGCCAGCCCAGGGAGGGG - Intronic
1122773404 14:104106923-104106945 CCCCAGGCCAGGCGTGGCTGGGG - Intronic
1122788661 14:104175387-104175409 GCTCAGGCCAGCCCCGCCCGAGG + Exonic
1122854488 14:104553582-104553604 ACCAACGCCAGGCCAGGCAGGGG + Intronic
1122881929 14:104694081-104694103 CCCTGGGCCAGGCCAGGCTGTGG + Intronic
1122892011 14:104736347-104736369 GCCCAGGGCTGGGCAGGACGAGG - Intronic
1122993196 14:105248600-105248622 AGCCCGGCCAGGCCCGGCCGCGG - Exonic
1123019210 14:105389770-105389792 GGCCAGGCCAGGGCTGGCAGTGG + Intronic
1123037173 14:105476201-105476223 GGCCGGGCCAGGCCAGCCTGGGG + Intronic
1123038603 14:105481372-105481394 GCCCAGGCCCCGCCAGGACATGG - Intergenic
1123060268 14:105591262-105591284 GCTCAGCCCAGCCCAGGCCAGGG + Intergenic
1123060272 14:105591272-105591294 GCCCAGGCCAGGGCAGCTCAGGG + Intergenic
1123114192 14:105886539-105886561 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123114200 14:105886571-105886593 GCCCAGGCCAGGTGAAGCCCAGG + Intergenic
1123114205 14:105886587-105886609 GCCCAGGCCAGGTGAAGCCCAGG + Intergenic
1123114211 14:105886603-105886625 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123114221 14:105886635-105886657 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123114229 14:105886667-105886689 GCCCAGGCCAGGTGAAGCCCAGG + Intergenic
1123114249 14:105886732-105886754 GCCCAGGCCAGGTGAAGCCCAGG + Intergenic
1123114255 14:105886748-105886770 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123114265 14:105886780-105886802 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123116409 14:105896147-105896169 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123118426 14:105905252-105905274 GCCCAGGCCAGGTGAAGCCCAGG + Intergenic
1123120644 14:105914848-105914870 GCCCAGGCCAGGTGAGGTCCAGG + Intergenic
1123120698 14:105915067-105915089 GCCCAGGTCAGGCAAGGCTGAGG + Intergenic
1123403415 15:20006630-20006652 GCCCAGGTCAGGCAAGGCTGAGG + Intergenic
1123421464 15:20140113-20140135 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1123443669 15:20306707-20306729 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1123512753 15:21013284-21013306 GCCCAGGTCAGGCAAGGCTGAGG + Intergenic
1123530690 15:21146653-21146675 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1123990050 15:25676354-25676376 GCCCAAGCCAAGCAAGGCCAGGG - Intergenic
1124338846 15:28876876-28876898 CCTCAGGCCTGGCCAGGCAGAGG + Intergenic
1124629101 15:31327081-31327103 GCCCAGCCCAGCCCAGCCCGAGG + Exonic
1125671991 15:41480446-41480468 GGCCAGGCCAAGACAGGCTGTGG + Intronic
1126497328 15:49306633-49306655 TACCAGGCCAGGCCAGCCCTAGG + Intronic
1128674280 15:69597238-69597260 TCCCAGGCCAGCCCAGGTTGAGG + Intergenic
1128758765 15:70200590-70200612 GGGCAGGCCTGGCCAGGCTGAGG + Intergenic
1129113450 15:73351781-73351803 GTCCAGGCCAGGAAAGGCCTTGG - Intronic
1129413203 15:75361029-75361051 GCCCAGGTCAGGCCAGGCCTTGG - Exonic
1129663056 15:77563983-77564005 GCCCAGCCCAGCCCAGCCCACGG + Intergenic
1129708322 15:77807186-77807208 GCCCAGAGCAGGGCATGCCGGGG - Intronic
1129851849 15:78798036-78798058 GGCGTGGCCAGGCCGGGCCGGGG + Exonic
1130540315 15:84817265-84817287 GCCCGGGTCGGGCCAGGCCAGGG + Exonic
1130542887 15:84834765-84834787 GCCCTGGCCAGGACAGCCCATGG - Intronic
1131144283 15:90001552-90001574 GGCCGGGCCGGGCCGGGCCGGGG - Exonic
1131368100 15:91856269-91856291 GCCCAGGAGAGGACAGGCCTAGG + Intronic
1131906354 15:97147361-97147383 GCAGAGGCCAGACAAGGCCGGGG + Intergenic
1132031832 15:98444830-98444852 GGCGAGGCCAGGCCAGGGCTGGG - Intronic
1132498194 16:273679-273701 GCCCAGCCCAGGCCAGGCTCCGG - Intronic
1132559570 16:587258-587280 GCCCAGGCCTGGCTTGGCCATGG + Intergenic
1132573731 16:655487-655509 CCCCATGCCGGGGCAGGCCGTGG - Intronic
1132614867 16:835451-835473 CCCCAGGCCAGGCCAGGGGCTGG + Intergenic
1132669818 16:1098001-1098023 GCCCTGGCCAGGCATGACCGCGG + Intergenic
1132685027 16:1158652-1158674 GCCCAGAGCAGGCCGGGCCCTGG + Intronic
1132744146 16:1429732-1429754 GCTGGGGCCAGGCCAGGCTGGGG + Intergenic
1132745199 16:1433562-1433584 GCCCAGACCTGGCCATGCCCTGG + Intergenic
1132759024 16:1500036-1500058 GCCCCGGGCTGGCCAGGCGGCGG + Intronic
1132853622 16:2035386-2035408 GGCCAGGCCAGGCCAGGGCTGGG - Intronic
1132853624 16:2035391-2035413 CCACAGGCCAGGCCAGGCCAGGG - Intronic
1132860091 16:2066306-2066328 GTCCAGGCCCGTCCAGGCTGTGG + Intronic
1132892052 16:2209337-2209359 GGCCAGGCTGGGCCAGGTCGGGG + Exonic
1132942584 16:2515270-2515292 GACCAGGCCAGGCCAGTCCACGG - Intronic
1132974672 16:2705406-2705428 GCCCGTGCCAGGCCAGGCTGTGG + Intronic
1133097761 16:3458596-3458618 GACCAGGCCAGGCGAGAGCGGGG - Intronic
1133116286 16:3579536-3579558 GCCCAAGCCATGCCAGGTTGGGG + Intergenic
1133202471 16:4212642-4212664 ACTCCGGCCAGGCCAGGCCCGGG + Intronic
1133225452 16:4338401-4338423 GCCCAGGCCAGGCCCAGCGGGGG - Exonic
1134062232 16:11206137-11206159 GGCCAGGCCAGGCCAGCTCAGGG - Intergenic
1135514732 16:23121447-23121469 GGCCGGGCCAGGCCAGGCCTAGG - Intronic
1136058044 16:27705389-27705411 GTCCAGGCCAGGCCAGCTCAGGG - Intronic
1136186273 16:28590673-28590695 GTCCAGGCCAGGGCAGGGCATGG + Intronic
1136188644 16:28602386-28602408 GTCCAGGCCAGGGCAGGGCATGG + Intergenic
1136191114 16:28615380-28615402 GTCCAGGCCAGGGCAGGGCATGG + Intronic
1136570461 16:31093631-31093653 CCCCAGACCAGGCCCGGACGTGG + Intronic
1136722541 16:32337184-32337206 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1136723473 16:32340784-32340806 GCCAGGGCCAGGCCAGGGCCAGG + Intergenic
1136840865 16:33543177-33543199 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1137505649 16:49051793-49051815 GGCCAGGCCAGGCCAGGCAGGGG - Intergenic
1138659937 16:58510959-58510981 GCTCAGGCAGGGCCAGGCCTGGG - Intronic
1139325190 16:66147345-66147367 GCTGTGGCCAGGCCAGGCCATGG + Intergenic
1139528471 16:67530227-67530249 GCCCTGGCCAGGCCCGGCCCGGG + Intronic
1139551074 16:67673412-67673434 TCCTAGTTCAGGCCAGGCCGAGG + Intergenic
1139634471 16:68249563-68249585 GACCAGACCAGACCAGACCGAGG - Intronic
1139949161 16:70660870-70660892 GCCCAGCCCAGCCCAGCCCAGGG + Intergenic
1139961830 16:70722326-70722348 CCCCAGGCCAGGCCCCTCCGAGG + Intronic
1141509181 16:84501572-84501594 GCGCAGACCAGGGCAGGCCCAGG + Intronic
1141524957 16:84605126-84605148 GCCCAGGCCATGGGGGGCCGTGG - Intronic
1141602743 16:85136440-85136462 GCCCAGCTGAGGCCAGGCCAGGG - Intergenic
1141665514 16:85463357-85463379 GCCCAGGCACAGCCAGACCGCGG - Intergenic
1141722249 16:85763021-85763043 GCCCAGGCCAGCCCCAGCAGGGG - Intergenic
1141979486 16:87541151-87541173 CCACAGGCCATGCCAGGCCTGGG - Intergenic
1142065540 16:88060291-88060313 CAGCAGGCCAGGCCAGGCTGGGG - Intronic
1142110096 16:88326769-88326791 GCCCTGGCCAGGGAAGGCCTGGG - Intergenic
1142131966 16:88435243-88435265 GCCCAGACCAGACCAGGCCAGGG + Exonic
1142138384 16:88461757-88461779 GGCCAGCCCAGTCCAGGGCGTGG - Intronic
1142355573 16:89600050-89600072 ATCCAGGCCTGGCCAGGCAGGGG + Intergenic
1203002959 16_KI270728v1_random:176981-177003 GCCAGGGCCAGGCCAGGGCCAGG - Intergenic
1203003890 16_KI270728v1_random:180580-180602 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1203134564 16_KI270728v1_random:1713387-1713409 GCCAGGGCCAGGCCAGGGCCAGG - Intergenic
1203135498 16_KI270728v1_random:1716987-1717009 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1203151030 16_KI270728v1_random:1843474-1843496 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1142594631 17:1023467-1023489 CCCCAGCCCAGGGCAGGTCGAGG + Intronic
1142720317 17:1771563-1771585 GCCCAGGCCTGGCCTGGCACTGG + Intronic
1143030364 17:3964145-3964167 GCGCGGGCCGGGCCGGGCCGGGG - Intronic
1143178058 17:4967890-4967912 GCCCAGGCCAGGCGGGCCCAGGG - Intergenic
1143234963 17:5391736-5391758 GCCCAGGCCTGAGAAGGCCGCGG - Intronic
1143513579 17:7408329-7408351 GCCCAGGCCGGGGCCGCCCGGGG - Exonic
1143561956 17:7701745-7701767 GTCTCGGCCAGGCCGGGCCGTGG - Exonic
1143608083 17:8002625-8002647 TGCCAGCCCAGGCCAGGGCGGGG - Exonic
1144065723 17:11622494-11622516 GCCCAGGCCAGGCATGGGCTGGG - Intronic
1144454221 17:15405905-15405927 GCTCAGGCCTAGCCAGGCTGAGG + Intergenic
1144495383 17:15742138-15742160 CCCCATCCCAGGTCAGGCCGTGG - Intronic
1144576915 17:16435295-16435317 GCTCAGCCCAGGCCTGGCTGGGG - Intronic
1144581163 17:16460383-16460405 GACCAGGCAAGGCCAGGAGGAGG - Intronic
1144672820 17:17142534-17142556 GCCCGGGCCAGGCCGGGCATGGG + Intronic
1145279516 17:21457600-21457622 GCCTAGGGCAGTCCAGGCAGGGG - Intergenic
1145750783 17:27353844-27353866 GCCCCGGCCGGGCCACGCTGGGG - Intergenic
1146264676 17:31444513-31444535 GTCCAGGGCAGACCAGGCTGAGG - Intronic
1146269700 17:31476862-31476884 GCCCAGCCCAGCCCTGGCAGGGG + Intronic
1146460085 17:33039324-33039346 GGCCAGGCCAGGCAAGGCTGAGG - Intronic
1146581225 17:34040192-34040214 GCCCAGGCCAGGTCAGGAGGTGG + Intronic
1147119971 17:38330160-38330182 GCCCAGGCTAGGCCGGCCCAAGG - Exonic
1147148086 17:38497837-38497859 CCCCATGCCAGCCCAGCCCGCGG - Intronic
1147249278 17:39143582-39143604 GACCAGGCTTGGCCAGGCCCAGG + Intronic
1147558844 17:41496803-41496825 GACCAGGCCCGGCCAGGACTGGG + Intergenic
1147647144 17:42040617-42040639 CACCAGGCCAGGCCAGGCCTCGG + Intronic
1147700149 17:42388526-42388548 GCCCAGCCCCAGCCTGGCCGAGG + Exonic
1147732707 17:42614018-42614040 TCCCAGGCCAGGCCGGCCCTGGG + Intronic
1147732708 17:42614019-42614041 GCCCAGGGCCGGCCTGGCCTGGG - Intronic
1147893474 17:43734122-43734144 TCCCAGGGCAGGCCAGGCCTAGG + Intergenic
1148109406 17:45136333-45136355 CCCCAGGACAGCCCAGGCAGGGG - Intronic
1148206770 17:45784366-45784388 GGCCGGGCCGGGCCGGGCCGCGG + Intronic
1148336062 17:46842024-46842046 GGCCAGCCCAGGCCCCGCCGAGG - Intronic
1148379934 17:47189054-47189076 GCCTAGGCCGCACCAGGCCGCGG + Intronic
1149772241 17:59331475-59331497 GCCCAGGCTGGGCCGGGCCGAGG + Intergenic
1150108534 17:62478945-62478967 GCCCAGGCCGGGCCAGGAGGTGG - Intronic
1150415891 17:64988594-64988616 GTCCAGGGCAGCCCAGGCTGAGG + Intergenic
1151177999 17:72305072-72305094 GGCCCAGCCAGGCCAGGCAGGGG + Intergenic
1151314408 17:73312541-73312563 GCCCAGTCCAAGCCTGGCCTCGG - Intergenic
1151509590 17:74550128-74550150 GACCCGGCCAGGCCAGGGCAGGG - Intergenic
1151562541 17:74878281-74878303 GCCAGGGCCAGGCCAGGGAGGGG + Exonic
1151661594 17:75521881-75521903 GCCCTGGCCCGGCCAGGGAGGGG + Exonic
1151678623 17:75612809-75612831 GCCCAGGCCAGGGCAGCCACTGG + Intergenic
1151772860 17:76176789-76176811 GCCAGGGCCAGGCCTGGGCGCGG + Intronic
1151876350 17:76869819-76869841 GCCCAGGCCAGGCAGGGCTGGGG + Intronic
1151938943 17:77281153-77281175 GACCAGACCAGGCCAGGCCGGGG - Intronic
1152032593 17:77853495-77853517 GCCCTCGCCAGGGCAGGCCATGG - Intergenic
1152066467 17:78115273-78115295 GCCAAGGCGAGGGCAGGGCGGGG - Intronic
1152101063 17:78301985-78302007 GTGCAGGGCAGGCCAGGCCTGGG - Intergenic
1152184152 17:78843660-78843682 GCCCAGGCCCGGGCAGGTGGCGG + Intergenic
1152206652 17:78977851-78977873 GCCCAGGGTGGGCCAGGCTGGGG + Intronic
1152226305 17:79094421-79094443 GCCCAGGCCCGCCCAGCCCTGGG - Intronic
1152278649 17:79372506-79372528 CCCAAGGCCAGGCCTGGCCCGGG + Intronic
1152278650 17:79372507-79372529 GCCCGGGCCAGGCCTGGCCTTGG - Intronic
1152525859 17:80887988-80888010 GCCCAGCCCGGCCCAGGCAGAGG - Intronic
1152564247 17:81093072-81093094 GCCCAGCCCAGCCCAGGGAGTGG - Intronic
1152564250 17:81093077-81093099 GCCCAGCCCAGCCCAGCCCAGGG - Intronic
1152578946 17:81157575-81157597 GCCCAGCCCAGGCCAGCCCAGGG + Intronic
1152621281 17:81366127-81366149 GCCCAGGGCAGGCCTGGCTGTGG - Intergenic
1152642213 17:81453996-81454018 GGCCACGCCAGGCCAGGGCCAGG + Intronic
1152732058 17:81977389-81977411 GCCGGGGCCAGGCTGGGCCGGGG - Intronic
1152734581 17:81991212-81991234 GCCCACGCCAGCACAGCCCGGGG - Intronic
1152794640 17:82301107-82301129 ACCCGGGTCAGGGCAGGCCGGGG + Intergenic
1154415581 18:14173805-14173827 GCCCAGGCTGGGCCAGGGCAGGG + Intergenic
1155021049 18:21897191-21897213 GTGCAGGCCAGGCCATTCCGGGG - Intergenic
1155160252 18:23189721-23189743 GCCTTGGCCAGGCCAGGACTTGG + Intronic
1156370091 18:36465418-36465440 GCCCTCGCCAGTCCAGGCCCAGG - Intronic
1157570127 18:48706660-48706682 GCCCACTCCAGGGCAGGCTGAGG - Intronic
1157606656 18:48930148-48930170 GCCCTGGCCTGGCCAGGCCCTGG - Intronic
1157745202 18:50129105-50129127 GCCCAGGCCAGGCCCCACGGTGG + Intronic
1157862514 18:51153848-51153870 CCCCAGGCCAGGGCTGGCCGAGG + Intergenic
1160218729 18:76957051-76957073 GCCATGGCCAGGCCACGCAGAGG + Intronic
1160309270 18:77773458-77773480 GACCAGGCCAGGACCGGCAGGGG + Intergenic
1160309328 18:77774468-77774490 GACCAGGCCAGGACGGGCAGGGG - Intergenic
1160328610 18:77972096-77972118 TCCCAGCCCAGGCCAGGCTAGGG + Intergenic
1160511940 18:79457752-79457774 GACCAGGCGAGGCCACGGCGAGG - Intronic
1160701541 19:509882-509904 GCCCAGGCGAGCCCAGGGCCGGG - Intronic
1160734443 19:655863-655885 GCCCAGACCAGGCCACGGCGGGG + Intronic
1160745555 19:709402-709424 GCTCGGGCCAGTCCAGGACGCGG + Intronic
1160760804 19:783207-783229 GCCCAGGCGCGGCCCGGCCGAGG - Intergenic
1160845306 19:1163687-1163709 GCACAGGCCAGGCGGCGCCGGGG + Intronic
1160853492 19:1205889-1205911 GCCCAGCCCATCCAAGGCCGCGG - Intronic
1160858081 19:1226331-1226353 GCCCAGGCCATGCCCGCCCCCGG - Intronic
1160938617 19:1609715-1609737 CCCCAGTCCAGGCCAGGCGGAGG - Exonic
1160942379 19:1626531-1626553 GCTCAGGACAGGCCGGGCCTCGG - Intronic
1160966281 19:1748320-1748342 GCCCGGAACAGGCCAGGCCCAGG + Intergenic
1161063137 19:2225223-2225245 ACCCAGTCCAGGCCTGGCCCAGG + Intronic
1161400772 19:4065636-4065658 GCGCAGGCCGGGCCCGGGCGTGG - Intronic
1161446950 19:4323829-4323851 ACACTGGCCAGGCGAGGCCGCGG + Exonic
1161569117 19:5020590-5020612 GCCCAGAGGAAGCCAGGCCGCGG + Intronic
1161582831 19:5090255-5090277 GCCCTGGCCTCGCCAGGCTGAGG + Intronic
1161587390 19:5113123-5113145 GGCCAGGCCAGGCCACGCAAGGG - Intronic
1161709897 19:5841940-5841962 GCCCTCGGCAGGCCAGGCCAGGG - Intergenic
1161716106 19:5877092-5877114 GCCCTCGGCAGGCCAGGCCAGGG - Intronic
1161858938 19:6783431-6783453 TCCCAGGCCAGGCCTGGAAGTGG + Intronic
1162022514 19:7874231-7874253 GCGCGGGCCAGGCCCGGCTGGGG - Intronic
1162044789 19:7991322-7991344 GGCCAAGCCAGGTCAGGCTGTGG + Intronic
1162046760 19:8005367-8005389 GCCCAGGCCGCGCCGGACCGGGG - Intronic
1162198961 19:9007579-9007601 TCCCAGCCCAGGCCTGGCCAGGG - Intergenic
1162422049 19:10571214-10571236 GCCCACGCCCGACCAGGCCATGG + Intergenic
1162512544 19:11128218-11128240 CCCCAAGCCAGGAGAGGCCGTGG - Intronic
1162914354 19:13866004-13866026 GCCCCGCTCAGGCCTGGCCGCGG + Intronic
1163006715 19:14401570-14401592 GGGCAGGGCAGGCCAGGCCAAGG - Intronic
1163430575 19:17264741-17264763 GCCCAGGCCTGAACAGGCAGTGG - Exonic
1163453770 19:17394143-17394165 GCCCCGGCTCGGCCATGCCGCGG + Intergenic
1163458016 19:17420166-17420188 GACCAGGCCAGGCCAGCCAGCGG - Exonic
1163697276 19:18770218-18770240 GGTCGGGCCAGGCCAGGCCCCGG - Intronic
1163698523 19:18775816-18775838 TCACAGGTGAGGCCAGGCCGGGG + Exonic
1163801210 19:19367004-19367026 GCCAAGGCCAGAGCAGGCCAGGG - Intergenic
1164571347 19:29376855-29376877 GCCAAGGACAGGCCACGCCAGGG - Intergenic
1164692534 19:30222189-30222211 GCCCTGGCCAGGCGAGGCAGGGG + Intergenic
1165811489 19:38614457-38614479 ACCCCGGCCAGGCCAGGCATTGG + Intronic
1165831082 19:38730772-38730794 ACCCATGCCAGGCAAGGCCTAGG + Exonic
1165838507 19:38773377-38773399 CCACAGCCCAGGCCAGTCCGTGG + Intronic
1165841052 19:38789320-38789342 CCACAGCCCAGGCCAGTCCGTGG - Intronic
1166121760 19:40690884-40690906 GCCCAGGCCAGGACGGACCGGGG - Intronic
1166127640 19:40725287-40725309 GCCAAGGCCAGGGAAGGCAGGGG - Intronic
1166364113 19:42269895-42269917 GCCCAGGCCAGCCCAGGCCCTGG - Intronic
1166677610 19:44749009-44749031 CCTCCGGCCGGGCCAGGCCGTGG - Exonic
1166697266 19:44859192-44859214 CCCCAGGCCAGGAAAGGCCAGGG - Intronic
1166796655 19:45430183-45430205 GCCCAGCACAGGACAGGCCTTGG + Intronic
1167216822 19:48170654-48170676 GGCCGGGCCAGGCCTGGGCGCGG + Intergenic
1167538495 19:50070727-50070749 GACCAGGCCAGGCCAGTCCAGGG - Intergenic
1167679655 19:50911428-50911450 GGGCAGGCCAGCCCAGGCTGAGG - Intergenic
1167870959 19:52369884-52369906 GGCGAGGCGAGGCCAGGCCCGGG - Intergenic
1168469228 19:56627465-56627487 GCCCAGGGCAGGTCAGGAGGTGG + Intergenic
1202691115 1_KI270712v1_random:96268-96290 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
925173378 2:1766494-1766516 GCCAAGGCCATGAGAGGCCGAGG + Intergenic
925416000 2:3670593-3670615 GCGCAGGCCAGGCCACGCTCTGG - Intronic
925883395 2:8371099-8371121 GCCCAGGCCATGCCAGGGAAGGG + Intergenic
925922209 2:8645541-8645563 CCCCAGGCCAGCCCAGGCCACGG + Intergenic
926038562 2:9654591-9654613 GTCCAGCCCAGCCCAGGCAGGGG + Intergenic
926525509 2:13974966-13974988 GCACAGGTCAGGCCCTGCCGTGG - Intergenic
926757057 2:16244748-16244770 GCCTGGGCCAGGCCAAGCAGGGG + Intergenic
927192548 2:20526765-20526787 CCCCAGGCCTGGCCAGGTGGTGG + Intergenic
927413272 2:22850894-22850916 TCCAAGACCAGGCCAGGCCCAGG + Intergenic
927638598 2:24833056-24833078 GTGGTGGCCAGGCCAGGCCGAGG - Intronic
928402069 2:30986220-30986242 GACCCAGCCAGGCCAGGCAGAGG + Intronic
928943745 2:36753643-36753665 GCACAGGCCTGGTCAGGCAGAGG + Intronic
929539581 2:42809978-42810000 GCCCCGGCCGGGCGAGGCCAGGG - Intergenic
929611963 2:43277305-43277327 GCTCAGGCCAGGCAAGGAAGAGG - Intronic
929668364 2:43851316-43851338 GTTCAGGCCAGGCCAGCCAGTGG - Intronic
929826381 2:45311867-45311889 GCAAAGGCCAGGCCAGGCCCTGG - Intergenic
930110543 2:47675279-47675301 GCCCAGCTCTGGCCAGGCCTTGG - Intergenic
930699689 2:54446823-54446845 TCCCAGGCGAGGCCAAGCAGGGG - Intergenic
931467664 2:62505820-62505842 GCGGAGACCAGGCCCGGCCGGGG + Intronic
931517774 2:63059783-63059805 GCCCAGGGCCTGCCGGGCCGCGG + Intergenic
931566810 2:63622894-63622916 GCGGGGGCCGGGCCAGGCCGGGG + Intronic
932442610 2:71747241-71747263 GCAAAGGCCAGGCCAGGCCCCGG + Intergenic
932616467 2:73234533-73234555 GCTCGGGCCGAGCCAGGCCGCGG - Intronic
932798107 2:74715405-74715427 GCTCAGGGCAGGCCGGGGCGGGG + Intergenic
933728070 2:85437657-85437679 GCGCAGGGCAGGCCAGGGGGCGG + Intergenic
933907955 2:86914005-86914027 GCCGCCGCCCGGCCAGGCCGAGG - Intronic
933907977 2:86914068-86914090 GCCCCGGCCTGGCCGGGCGGCGG + Intronic
933907978 2:86914069-86914091 GCCGCCGCCCGGCCAGGCCGGGG - Intronic
933907997 2:86914117-86914139 GCCCCGGCCTGGCCGGGCGGCGG + Intronic
933907998 2:86914118-86914140 GCCGCCGCCCGGCCAGGCCGGGG - Intronic
933908028 2:86914195-86914217 GCCGCCGCCCGGCCAGGCCGAGG - Intronic
933908039 2:86914223-86914245 GCCGCCGCCCGGCCAGGCCGAGG - Intronic
933908074 2:86914319-86914341 GCCGCCGCCCGGCCAGGCCGAGG - Intronic
933908130 2:86914481-86914503 GCCGCAGCCCGGCCAGGCCGAGG - Intronic
933908148 2:86914530-86914552 GCCGCCGCCCGGCCAGGCCGAGG - Intronic
933955278 2:87357683-87357705 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
934011423 2:87824721-87824743 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934011438 2:87824761-87824783 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934011454 2:87824804-87824826 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934011466 2:87824835-87824857 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934011554 2:87825389-87825411 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934011571 2:87825435-87825457 GCCGCCGCCCGGCCAGGCCGAGG + Intronic
934239466 2:90253896-90253918 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
934273719 2:91562802-91562824 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
934736344 2:96691667-96691689 GCCCCAGCCAGGCCAGGCCCTGG - Intergenic
935260307 2:101350032-101350054 GCCCAGGGCCGGGCAGGCAGTGG + Exonic
935775081 2:106466122-106466144 GCCCGGGCCAGGACGGGCCCAGG + Intronic
935904988 2:107829774-107829796 GCCCGGGCCAGGACGGGCCCAGG - Intronic
936055294 2:109257895-109257917 GCCCAGGACAGCCCTGGCCCTGG - Intronic
936126765 2:109794846-109794868 GCCCGGGCCAGGACGGGCCCAGG - Intronic
936217932 2:110576640-110576662 GCCCGGGCCAGGACGGGCCCAGG + Intronic
936521610 2:113215330-113215352 GCACAGGCCAGGCCAGCCCAGGG - Intergenic
936600408 2:113889920-113889942 GCCTGGGCCTGGCCTGGCCGGGG + Intergenic
936600409 2:113889921-113889943 GCCCCGGCCAGGCCAGGCCCAGG - Intergenic
937238254 2:120443369-120443391 GCTCAGCCCAGGGCTGGCCGTGG + Intergenic
937252641 2:120534211-120534233 GCTCTGGCCAGGCCAGGAGGTGG + Intergenic
937291918 2:120787109-120787131 CCCCCTGCCAGGCCAGGCAGGGG - Intronic
937853449 2:126656200-126656222 GGCCGGGCCAGGCCGGGCCGGGG - Exonic
938343408 2:130549843-130549865 GCTCAGGCCAGGGCCGGCGGGGG - Exonic
938346425 2:130570879-130570901 GCTCAGGCCAGGGCCGGCGGGGG + Exonic
938381182 2:130837328-130837350 GCCCAGGCCGGTCCAGGCAGCGG - Intronic
938405968 2:131033398-131033420 GGCCAGGCCTGGGCAGGCAGGGG - Intronic
938440889 2:131331301-131331323 GCGCAGGCCTGGCCTGGCGGAGG + Intronic
939961459 2:148569365-148569387 GCCCAGGTGAGGCCAGGCTGAGG + Intergenic
944142838 2:196475792-196475814 GCCCAGGCCAGGCCAATCAGAGG - Intronic
944843530 2:203646311-203646333 GCCCAGGCCTAGCAAGGCCCAGG - Intergenic
945241541 2:207681405-207681427 GGCGCGGCCAGGCCAGGCCCGGG + Intergenic
945632859 2:212304424-212304446 GCCCAGGCCAGCCCAGACACAGG - Intronic
946180165 2:217944100-217944122 TCCCAGGCCAGCCCAGGGGGCGG + Exonic
946189674 2:218001798-218001820 GCCCAGGCAAGCCCATGCTGGGG - Intronic
946191554 2:218010397-218010419 GCCCAGTCCGGGCCGCGCCGCGG - Intergenic
946405970 2:219492297-219492319 GCACAGGCCAGGCCAGGGGCAGG - Intronic
947622076 2:231597290-231597312 GGCCAGGCCAGGCCAGGGCCAGG + Intergenic
947623194 2:231604083-231604105 GGCCAGGCCAGGCCACCCCTGGG - Intergenic
947860475 2:233354435-233354457 GCCGAGGGCGGGCCGGGCCGGGG - Intergenic
947866354 2:233400455-233400477 GCCCAGGCCAGGACAGCATGAGG - Intronic
948223812 2:236293439-236293461 GCCCAGGCCAGGTGAGTCTGGGG + Intergenic
948257021 2:236576058-236576080 GCCCATGCCAGGGCAGGCAGGGG - Intronic
948302971 2:236922211-236922233 GCCAAGGCCTGGCCAGGAGGAGG - Intergenic
948412537 2:237775177-237775199 GCCCAGGCCAGGGCAGTTCTAGG + Intronic
948460435 2:238127629-238127651 GGCCAGGCCAGGCCGGGCTGAGG - Exonic
948473631 2:238203108-238203130 GCGCAAGGCAGCCCAGGCCGCGG + Intronic
948562603 2:238864543-238864565 CCCCAGGCCAGGTCAGCCTGGGG + Intronic
948803256 2:240442232-240442254 GCTCAGGCCTGCCCAGGCGGGGG - Intronic
948879658 2:240850367-240850389 GCCCAGGGCAGGCCCAGCCAGGG + Intergenic
948879673 2:240850411-240850433 GCCCAGGGCAGGCCCAGCCAGGG + Intergenic
948879688 2:240850455-240850477 GCCCAGGGCAGGCCCAGCCAGGG + Intergenic
948879703 2:240850499-240850521 GCCCAGGGCAGGCCCAGCCAGGG + Intergenic
948993074 2:241564465-241564487 GCCGGGCCCAGGCCAGGCTGAGG + Intronic
949037324 2:241821839-241821861 GCCCAGGCTGGGCCGGGCAGTGG + Intergenic
1168753203 20:297994-298016 GGCCAGGCCCGGCGAGGCCGAGG + Exonic
1168968321 20:1913530-1913552 GCCCAGGTCAGGGCAGGACAAGG + Intronic
1169081036 20:2797899-2797921 ACCCAGTCCAGGCTAGGCTGAGG - Intronic
1170386003 20:15817848-15817870 GGCCAGGCCAGGCCACACTGAGG - Intronic
1170524760 20:17226843-17226865 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
1170932312 20:20780271-20780293 GCCCAGACCATGCCAAGCCCTGG - Intergenic
1171291226 20:23984228-23984250 GGCCAGGTGAGGCCAGGTCGGGG - Intergenic
1171293739 20:23998426-23998448 TCTGAGGTCAGGCCAGGCCGTGG - Intergenic
1171420340 20:25013594-25013616 GGCCATGCCCGGCCAGGCCTGGG + Exonic
1171796032 20:29567458-29567480 TCACGGGCCAGGCCAGGCGGAGG + Intergenic
1171852196 20:30316685-30316707 GGCCGGGCCAGGCCAGGCGGAGG - Intergenic
1172008791 20:31834452-31834474 GCCCAGCCCAGGCCTGGTGGAGG + Exonic
1172213544 20:33217609-33217631 GCTTGGGCCAGGCCAGGCCAAGG - Exonic
1172445434 20:34990833-34990855 GCCCCAGCCAGGCCAGCCCTGGG - Intronic
1172484571 20:35290707-35290729 GCACAGGCCTGGCCAGGGTGGGG + Intronic
1173279808 20:41618181-41618203 GTCCAGGCCCGGCCGGGCTGGGG - Intronic
1173918196 20:46725326-46725348 GCCCAGGACCAGCCAGGCCAGGG - Exonic
1174099872 20:48119187-48119209 GGCCAGGCCAGGGCCTGCCGTGG - Intergenic
1174481088 20:50832016-50832038 GCCCAGGCCAGGCGAGAACCAGG - Intronic
1175399650 20:58693092-58693114 GCCCAGGCCCGGGCGGCCCGCGG + Intronic
1175429830 20:58892665-58892687 TCCCGGGCCAGGCCGGGCCGTGG + Intronic
1175470201 20:59222217-59222239 GCCCAGCTCAGCCCAGCCCGTGG - Intronic
1175561328 20:59933366-59933388 GCCGAGGCTGGGCCAGGGCGTGG - Intronic
1175715668 20:61252966-61252988 GCCGAGCCCAGCCCCGGCCGTGG + Intronic
1175837250 20:62004063-62004085 GGCCAGACCAGGGCAGGACGTGG + Intronic
1175888258 20:62304264-62304286 GCCCATGAAAGGCAAGGCCGGGG - Intronic
1175894320 20:62329373-62329395 GCCCAGCCCAGCCCAGCCCTGGG + Intronic
1175901391 20:62361249-62361271 ACCCAGGCCAGGGCAGGGCTAGG + Intronic
1175911351 20:62406878-62406900 GGCCAGGTCAGCCCAGGACGCGG - Intronic
1175994353 20:62805429-62805451 TCCCAGGCCAGACCCGGCCCGGG - Intronic
1176091368 20:63319957-63319979 CCCAAGGCCAGGCCAGGGCTGGG - Intronic
1176122429 20:63460175-63460197 GCCCAGGCCAGGCCAAGCAGGGG - Intronic
1176131325 20:63497979-63498001 GCCCTGGCCAGGCCCAGCTGTGG - Intronic
1176221042 20:63969555-63969577 GGCCCTGCCCGGCCAGGCCGAGG - Intronic
1176221143 20:63969836-63969858 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
1176231056 20:64033154-64033176 GGCCAGGACAGGCCAGACTGGGG - Intronic
1176235422 20:64051428-64051450 GCCCAGGCTGAGCCAGGCCCTGG - Intronic
1176592998 21:8660232-8660254 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1178974114 21:37207491-37207513 AACCAGGCAAGGCCAGGCGGTGG - Intergenic
1179013454 21:37574454-37574476 GCCCTGGCAAGGCCAGGCTGCGG + Intergenic
1179231664 21:39509295-39509317 CATCAGGCCAGGCCAGGCCAGGG + Intronic
1179373245 21:40826376-40826398 GGCCAGCCCAAGCCAGGCCATGG + Intronic
1179438067 21:41375535-41375557 GCCCAGGCCAGGGAATGCCAAGG - Intronic
1179556653 21:42182881-42182903 GCCCAGCCCAGCCCAGCCAGCGG + Intergenic
1179577544 21:42317374-42317396 CCAGAGGCCAGGCCAGGTCGTGG + Intergenic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1179998842 21:44986114-44986136 GCCCAGGCCAGCCCGGGCAGGGG + Intergenic
1180154204 21:45970372-45970394 CCCCAGGCCAGGCTACGCCTGGG - Intergenic
1180174801 21:46082335-46082357 CCCGAGGCCAGGCCAGGTGGGGG + Intergenic
1180188872 21:46153406-46153428 GCCCCGGCCAGGCCAAGAGGGGG + Intronic
1180198112 21:46209358-46209380 CCCCAGGTGAGGCCAGCCCGAGG + Intronic
1180225643 21:46390540-46390562 ACCCAGGCAGGGCCAGGCCAGGG - Intronic
1180275845 22:10637359-10637381 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1180285569 22:10741881-10741903 GCACAGGTCCTGCCAGGCCGCGG + Intergenic
1180550332 22:16532304-16532326 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1180581952 22:16846111-16846133 GCCCAGCCCTGGCCAGCCCGGGG + Intergenic
1180766177 22:18346866-18346888 GGCCAGGTGAGGCCAGGTCGGGG + Intergenic
1180780136 22:18515512-18515534 GGCCAGGTGAGGCCAGGTCGGGG - Intergenic
1180791829 22:18578741-18578763 GCTCAGGCCAGCCCAGCCCCTGG - Intergenic
1180812852 22:18772833-18772855 GGCCAGGTGAGGCCAGGTCGGGG - Intergenic
1180843668 22:18970513-18970535 GCCCAGCCCCGGCCCGGCAGCGG - Intergenic
1180960037 22:19758448-19758470 GCACAGGCCAAGTCAGGCCTTGG + Intronic
1180960306 22:19759414-19759436 GCCCAGCCCAGCCCAGCCCACGG - Intronic
1180980883 22:19877451-19877473 GGCCAGGGCAAGCCAGGGCGTGG - Intronic
1181027113 22:20132622-20132644 GCCCAGGCCAGGCCACACCCAGG + Intronic
1181028907 22:20140704-20140726 GCCCAGGCCGGGCCTCACCGGGG - Exonic
1181053489 22:20248615-20248637 GCCCATACAAGACCAGGCCGAGG + Intronic
1181057807 22:20268191-20268213 GCCCGGCCCCGGCCCGGCCGCGG + Exonic
1181199010 22:21207081-21207103 GGCCAGGTGAGGCCAGGTCGGGG - Intergenic
1181229907 22:21416568-21416590 GCTCAGGCCAGCCCAGCCCCTGG + Intergenic
1181248742 22:21518298-21518320 GCTCAGGCCAGCCCAGCCCCTGG - Intergenic
1181275656 22:21686300-21686322 GCCAAGGCTAGGCCAAGCCAGGG - Intronic
1181400734 22:22648707-22648729 GGCCAGGTGAGGCCAGGTCGGGG + Intergenic
1181414628 22:22750483-22750505 GCAGATGCCAGGCCAGGCCTCGG + Intronic
1181439879 22:22930288-22930310 GGCCAGGCACGGCCAGGCCTGGG - Intergenic
1181440420 22:22932757-22932779 GCCCTGCACAGGCCAGGCCTCGG - Intergenic
1181514299 22:23402475-23402497 GCTCCGGCCGGGCCTGGCCGCGG + Intergenic
1181519042 22:23434825-23434847 TGCCAGGAGAGGCCAGGCCGAGG + Intergenic
1181643487 22:24217346-24217368 CCCAAGGCCAAGCCAGGCAGGGG + Intergenic
1181648657 22:24247171-24247193 GCCCAGGTGAGGCCAGGTCGGGG - Intergenic
1181702714 22:24629805-24629827 GGCCAGGTGAGGCCAGGTCGGGG + Intergenic
1181803079 22:25359783-25359805 GCCAGGGCCAGGCCAAGCAGAGG - Intronic
1181910693 22:26235996-26236018 GCCAAGGCCAGGCCAAGGCCAGG - Intronic
1182068638 22:27447634-27447656 GGACAGTCCAGGCCAGGACGAGG + Intergenic
1182358634 22:29734152-29734174 GGCCAGGCCTGGCCTTGCCGAGG + Intronic
1182485102 22:30634816-30634838 TTCCAGGCTAGGCCAGGCCCTGG - Intergenic
1183305307 22:37079935-37079957 AGCCAGGCCAGGCCGGGTCGGGG + Intronic
1183346082 22:37309134-37309156 ACACAGGCCAGGCCAGGCCTAGG + Intronic
1183354020 22:37349068-37349090 GCCCAGCCCAGGCTAGCGCGTGG - Intergenic
1183357488 22:37367438-37367460 GCCCAGGCCAGGCGTGGAGGAGG + Intergenic
1183485088 22:38084248-38084270 CCCCAGGCCAGGCTGGGCCTCGG + Intergenic
1183590278 22:38775863-38775885 CCCAAGGCGTGGCCAGGCCGCGG + Intronic
1183639577 22:39084808-39084830 AGCTGGGCCAGGCCAGGCCGAGG + Intronic
1184246587 22:43238790-43238812 GGCCAGGCCAGTACAGGCAGGGG + Intronic
1184275350 22:43406596-43406618 GACCATGCCCTGCCAGGCCGAGG - Intergenic
1184454202 22:44599788-44599810 GCCAAGGGCAGGCCAAGCCCTGG - Intergenic
1184461316 22:44639851-44639873 TCCCAGGCCATGCCTGGCTGAGG + Intergenic
1184509600 22:44925914-44925936 CCCCAGGCCAGCCCAGACTGTGG + Intronic
1184557442 22:45240935-45240957 GCCCCGGCCCGGCCCGGCCCCGG + Intergenic
1184805550 22:46792930-46792952 GGCCAGGACAGGCCAGGGCCGGG - Intronic
1185107908 22:48884871-48884893 GACTGGGCCAGGCCAGGCCGGGG - Intergenic
1185109680 22:48894037-48894059 GCCCGGGGCAGGCCAGGGCTGGG + Intergenic
1185157319 22:49201840-49201862 GCCCCAGCCAGTCCAGGCCTGGG + Intergenic
1185170547 22:49291281-49291303 GCCCAAACCAGGCAATGCCGAGG - Intergenic
1185194182 22:49458172-49458194 GCCGAGGCCTGGCCAGGATGGGG + Intronic
1185206246 22:49540882-49540904 GCCCAGGCCATTCCTGGCCCAGG - Intronic
1185219469 22:49622298-49622320 GCCCAGCTCAGCCCACGCCGGGG + Intronic
1185324658 22:50219757-50219779 GCCCAGAGCAGCCCAGGCCGTGG - Exonic
1185340187 22:50287612-50287634 CCCCAGGCCGGGCCAGGTGGGGG - Intronic
1203227795 22_KI270731v1_random:87757-87779 GGCCAGGTGAGGCCAGGTCGGGG + Intergenic
949559266 3:5187586-5187608 GCCCAGGCCGGGCCAATCCCGGG + Intergenic
950548106 3:13650744-13650766 GTGCAGGCCAGGCCCGGCCGGGG + Intergenic
950548107 3:13650749-13650771 GGCCAGGCCCGGCCGGGGCGAGG + Intergenic
952382677 3:32817224-32817246 GCCCAGGCCAGGCGAGGCGGGGG + Intergenic
952966428 3:38623763-38623785 GCACAGACCAGGCCTGGCTGCGG + Intronic
953331133 3:42053673-42053695 GACCAGCCCAGGTCAGGCAGGGG - Intronic
954370494 3:50167466-50167488 GCCCAGGACAGGATAGGCTGAGG - Intronic
954380151 3:50215033-50215055 GCCCACACAAGGCCTGGCCGTGG - Intronic
954453212 3:50582862-50582884 GCCCAGGCCAGGGCAGCCAGTGG + Exonic
954828517 3:53397565-53397587 CCCCAGCCCAGGACAGGCCCTGG + Intergenic
959632132 3:108518625-108518647 GCCCCAGCCAGGTCAGGCCTGGG - Intronic
960587695 3:119335477-119335499 CCCTAGGCCAGGGCAGGCCAGGG + Intronic
961784746 3:129341126-129341148 GCCCTGGGCAGGACAGGCCACGG + Intergenic
962222444 3:133574430-133574452 GCCCTGGCGAGCCCAGCCCGAGG - Intronic
962809348 3:138947639-138947661 GCGAGGGACAGGCCAGGCCGAGG - Intronic
963666809 3:148198437-148198459 CCCCACGACAGGCCAGGCCCCGG + Intergenic
963814282 3:149812758-149812780 GCCAGGGCCAGGCCCGCCCGGGG + Exonic
964705734 3:159616657-159616679 GCCTAGGCTAGGCCATGCTGTGG + Intronic
964720419 3:159763958-159763980 GGCCGGGCCGGGCCGGGCCGGGG + Intronic
964974112 3:162599639-162599661 GCCTAGGCCAGCCCAGGAAGGGG - Intergenic
965040239 3:163498964-163498986 GCCTAGGCCAGCCCAGGAAGGGG - Intergenic
966594001 3:181710764-181710786 GCCCAGGCCGCGCAAGGCTGGGG - Intergenic
967278058 3:187795754-187795776 GGCCAGGCCAGACCAAGCCAAGG + Intergenic
967387846 3:188928324-188928346 GCTCAGGGCAGGCCAGGCCCTGG - Intergenic
968081080 3:195847445-195847467 CCCCAGGACAGGCTTGGCCGTGG - Intergenic
968121434 3:196128661-196128683 GGCGAGGCCAGGCGAGGCCTGGG - Intergenic
968383163 4:112067-112089 GCCCAGGCCAGCCCTGGATGTGG - Intergenic
968517660 4:1021669-1021691 GCCCAGGCCCGGCTGGGCCCTGG + Intronic
968550795 4:1222598-1222620 CCTCAGGCCAGGCCTGGGCGGGG + Intronic
968552707 4:1231877-1231899 GCTCAGCGCAGGCCAGGCCAGGG + Intronic
968556139 4:1247444-1247466 GGCCAGGCCCGGGCAGGCAGGGG + Intronic
968556352 4:1248216-1248238 GCCCAGGCAAGGGCAGGTGGGGG + Intronic
968578333 4:1378164-1378186 GCCAGGGCCTGGCCAGGCCGTGG + Intronic
968607212 4:1541200-1541222 GCCCAGGCCTGCCCAGCTCGGGG + Intergenic
968812595 4:2806691-2806713 GCTCTGGCCTGGCCAGGCAGGGG - Intronic
968897910 4:3415561-3415583 AGCCAGGCCGGGCCAGGCCAAGG - Intronic
968904432 4:3444954-3444976 GCCCAGGCCCAGCAGGGCCGCGG - Exonic
969298260 4:6282032-6282054 GCCTGGCCCAGGGCAGGCCGTGG + Intronic
969604912 4:8197632-8197654 GGCCTGGCCAGGCCGGGCCGGGG + Intronic
969690904 4:8703588-8703610 GCCCCGGACAGGCCTGGCGGAGG + Intergenic
969695921 4:8734826-8734848 GGCCTGGCCTGGCCAGGCCAGGG + Intergenic
970453090 4:16191322-16191344 GCCCTGGCCAGGCCTGTGCGGGG + Intronic
970641429 4:18070619-18070641 GCCCAGCTCAGGCCAGCCCATGG + Intergenic
971316455 4:25572048-25572070 GCAAAGGCCAGGCCAGGTCAAGG - Intergenic
971330905 4:25680717-25680739 TCCCAGGCCAGTCCTGGCCTCGG - Intergenic
972350726 4:38233926-38233948 ACCCAGCACAGGCCAGGCAGTGG + Intergenic
972670968 4:41214045-41214067 CCCCAGGCCCTGCCAAGCCGGGG + Intronic
979349459 4:119628062-119628084 GCCCAGCCAGGGCCAGGGCGAGG + Intronic
980923960 4:139115515-139115537 GGCGCGGCCAGGCCAGGCCCGGG - Intronic
985680412 5:1252990-1253012 TCCCAGGCCCAGCCAGGCCATGG + Intergenic
985723431 5:1502548-1502570 CCCCACGCCAGGGAAGGCCGAGG + Intronic
985811669 5:2094738-2094760 GGCCAGGCCAGCCCTGGCCCCGG + Intergenic
985883496 5:2658142-2658164 GCCCAGACAAGGCCAGGGTGGGG - Intergenic
986251331 5:6061101-6061123 GCCCATGCCAGCCCATGCCATGG + Intergenic
988781854 5:34529580-34529602 TCCCAGCCCAGCCCAGGCCACGG + Intergenic
992111580 5:73498849-73498871 GCCGAGGCCAGGCCAGGGCCAGG + Intronic
993168020 5:84382892-84382914 GCCCAGGCAAGGCGCGGCCATGG + Intronic
997282157 5:132656161-132656183 GCACCGGCCATGTCAGGCCGAGG - Intergenic
997337468 5:133118375-133118397 CCCCAGGGCAGGTCAGGCTGTGG - Intergenic
997366276 5:133327198-133327220 GCCCAGGACAGGCCTAGCTGAGG + Intronic
997529213 5:134571837-134571859 ATCCAAGCCAGGCCAGGCTGGGG - Intronic
998160644 5:139811046-139811068 GCCCAGCACAGGCCTGGCAGAGG + Intronic
998406679 5:141878266-141878288 GCCCAGGCCGGGGCCGGCGGCGG - Exonic
998849331 5:146338786-146338808 GGAGAGGCCAGGCCAGGCCCGGG + Intronic
999565425 5:152854937-152854959 GCCCAGGACAGAAGAGGCCGGGG + Intergenic
1000302919 5:159972194-159972216 GCCCGGGCTCGGCGAGGCCGAGG - Exonic
1001052861 5:168426740-168426762 GTCCAGGGCATGGCAGGCCGGGG - Intronic
1002026750 5:176400971-176400993 GGCCAGGGCAGGCCAGGACAGGG + Intronic
1002109605 5:176899468-176899490 GCCCAGGCTAGGCAAGGCTGTGG + Intergenic
1002164158 5:177334247-177334269 GCCCAGGCCCAGGCAGGGCGGGG + Intronic
1002313349 5:178328023-178328045 GCCCAGGCCTGGCCAGAGCCTGG - Intronic
1002316595 5:178348157-178348179 GCCAAGGCAAGGCCAGTCGGGGG - Intronic
1002322688 5:178384982-178385004 GCCCAGCCCACTCCACGCCGGGG + Intronic
1003370238 6:5517898-5517920 GCACAGCCCAGGCCAAGGCGGGG - Intronic
1004429639 6:15532039-15532061 GCCAGGGCCAGGCAAGGCTGGGG + Intronic
1005969888 6:30752614-30752636 GGCAAAGCCAGGCCAGGCAGAGG - Intergenic
1006081854 6:31572420-31572442 GCCCAGGCCCAGGCAGGCCGGGG - Intronic
1006418305 6:33918390-33918412 GCCCAGCCCCGGCCAGGCCTTGG + Intergenic
1006456255 6:34133560-34133582 GCCCATGCCCACCCAGGCCGTGG - Exonic
1006517388 6:34552559-34552581 GCACAGGCCAGGGAAGGCAGAGG + Intronic
1006599159 6:35214294-35214316 GCCCCGCCGGGGCCAGGCCGGGG - Intergenic
1007809496 6:44476077-44476099 GCCCTGGCCAGGCCAGTGAGGGG - Intergenic
1007815927 6:44525547-44525569 AGCCAGGCCAGGGCAGGCCAAGG - Intergenic
1012475781 6:99613761-99613783 GAGCAGGGCAGGCCAGGCGGCGG - Exonic
1014057253 6:117030560-117030582 GCCCAGGCCAGCCCAGCCCTGGG + Intergenic
1014191480 6:118501291-118501313 GTCCAGGCCAGGCGAGGTGGAGG + Intronic
1017847548 6:158272472-158272494 TCCCAGGCCAGCCAAGGCAGAGG + Intronic
1017955514 6:159174404-159174426 GCGCTGCCCAGGCCGGGCCGAGG - Intronic
1018134290 6:160764586-160764608 GGCCAGGCCAGGCCAGAGCAGGG + Intergenic
1018864665 6:167737290-167737312 GCCCAGGCCAGGCGGCGCCCTGG - Intergenic
1019168772 6:170117002-170117024 GCCCAGGAGAGGCCAGTCCTGGG + Intergenic
1019275245 7:172714-172736 GCCCAGGTCAGCCCAGTTCGGGG + Intergenic
1019275257 7:172744-172766 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275269 7:172774-172796 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275281 7:172804-172826 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275293 7:172834-172856 GCCCAGGTCAGCCCAGTCCGGGG + Intergenic
1019275306 7:172864-172886 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275318 7:172894-172916 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275330 7:172924-172946 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275342 7:172954-172976 GCCCAGGTCAGCCCAGTGCGGGG + Intergenic
1019275354 7:172984-173006 GCCCAGGTCAGCCCAGTCCGGGG + Intergenic
1019275367 7:173014-173036 GCCCAGGTCAGCCCAGTCCGGGG + Intergenic
1019275380 7:173044-173066 GCCCAGGTCAGCCCAGTCCGGGG + Intergenic
1019275391 7:173074-173096 GCCCAGGTCAGCCCAGTCCGGGG + Intergenic
1019328890 7:453029-453051 GAACAGGGCAGGCCAGGCGGGGG + Intergenic
1019339616 7:502713-502735 GCCCAGTCCAGGCCAGAGAGGGG + Intronic
1019405918 7:883990-884012 GCGCAGTCCAAACCAGGCCGGGG + Intronic
1019473115 7:1231642-1231664 GCCTCGGCCAGCCCAGGGCGGGG - Intergenic
1019485201 7:1286071-1286093 GCCCAGGCCGTGCCACGCCGCGG - Intergenic
1019504731 7:1385252-1385274 GGCCGGGGCAGGGCAGGCCGGGG + Intergenic
1019592239 7:1841501-1841523 TGCCAGGAGAGGCCAGGCCGAGG - Intronic
1019606105 7:1910973-1910995 GCCCAGACCAGGCCCCGCCAGGG - Intronic
1019609860 7:1930894-1930916 GCTCAGGGCCAGCCAGGCCGGGG + Intronic
1019709175 7:2510594-2510616 CCCCAGGCCCTGCCAGGCCCAGG - Intergenic
1019769896 7:2877000-2877022 GCCCAGGCCAAGACCAGCCGGGG - Intergenic
1020080318 7:5283061-5283083 CCCCAGGCCGGGCCGGGCCGAGG + Exonic
1020660347 7:10974117-10974139 GCCAGGGCCAGGCGAGGCCGGGG + Exonic
1022097953 7:27152465-27152487 CGCCAGGCCTGGCCTGGCCGGGG + Intronic
1022375380 7:29806906-29806928 GGCCCGGCCCGGCCCGGCCGGGG - Intronic
1022500232 7:30878119-30878141 GGCCAGGCCAGGCCAGAGCAAGG - Intronic
1022505370 7:30906143-30906165 GCCGAGGCCACTCCAGGCAGAGG + Intergenic
1022537350 7:31106421-31106443 CCCCAGGCCAGGACAGGGCCTGG + Intronic
1023043806 7:36194668-36194690 GTCCAGCCCAGGCCTGGCCTGGG - Intronic
1023055960 7:36290311-36290333 GTCAAGGCCAAGCCAGGCTGTGG - Intronic
1023652547 7:42387236-42387258 CCCCAGGCCAAGGCAGGCCAAGG - Intergenic
1023883405 7:44334504-44334526 CCCCAGGCCTGGCCAGGACCTGG - Intronic
1023937304 7:44748970-44748992 GGCCGGGCCAGGCCGGGCGGAGG + Exonic
1024030382 7:45455547-45455569 GCTCAGGCCAGGCCTGACCTGGG - Intergenic
1024219933 7:47279352-47279374 GCCCAGGCCAAGCAAGGCCACGG + Intronic
1024234894 7:47390581-47390603 GCCCAGGCCTGGCAATGCCACGG + Intronic
1024472302 7:49775953-49775975 GCACAGGCACGGGCAGGCCGAGG - Exonic
1024976630 7:55119652-55119674 GGCCAGGCCACGCCAGAGCGAGG - Intronic
1025198599 7:56949118-56949140 CCCCAGGCCGGGCCGGGCCGAGG - Intergenic
1025673353 7:63627818-63627840 CCCCAGGCCGGGCCGGGCCGAGG + Intergenic
1026837283 7:73647463-73647485 GCCCAGCCCAGTCCAGCCAGTGG + Intergenic
1026909450 7:74083864-74083886 GGCCGGGCCGGGCCGGGCCGGGG - Intronic
1026982766 7:74536304-74536326 GCCCAGAGCAGGGCTGGCCGCGG - Intronic
1029440259 7:100583425-100583447 TCCCAGGACAGGCTGGGCCGAGG - Intronic
1029544177 7:101201771-101201793 GGACAGGCGAGGCCAGGCGGTGG + Intergenic
1032037570 7:128531486-128531508 GCCCAGGCCGGGCCAGGAGGTGG - Intergenic
1033456117 7:141505504-141505526 GCCCAGGACTTGCCAGGCCCAGG - Intergenic
1033756958 7:144403779-144403801 GCACGGGCCGGGCCGGGCCGGGG + Intronic
1034251244 7:149692640-149692662 GCCGAGGCCAGGGGAGGCTGCGG - Intergenic
1034417225 7:150971521-150971543 AGCCAGGCCAGGCCAGTCAGAGG + Intronic
1034419047 7:150979415-150979437 GCCCCGGGAAGGCCAGGGCGGGG + Intergenic
1034956705 7:155339553-155339575 GCCCAGGGCAGCCCAGGGAGGGG + Intergenic
1035288069 7:157818961-157818983 TCTCAGGACAGGCCAGGCCCAGG + Intronic
1035315825 7:157997253-157997275 GCCCAGGCCAGGCGGGCCCAGGG - Intronic
1035331127 7:158098189-158098211 CCCCAGTCCTGGCCAGGCAGAGG - Intronic
1035556649 8:572184-572206 GCCAGGGACAGGCCAGGCCGAGG + Intergenic
1035715194 8:1748709-1748731 GCTCAGGCCAGGGCAGGGTGGGG - Intergenic
1036283729 8:7424391-7424413 GACCAGGCCAGCCCAGGCTCTGG - Intergenic
1036337742 8:7887138-7887160 GACCAGGCCAGCCCAGGCTCTGG + Intergenic
1036400382 8:8402470-8402492 GCCCAGTGCAGGCCAAGCCATGG + Intergenic
1037803810 8:22048874-22048896 GCCGTGGCCACGCCCGGCCGGGG - Intergenic
1040039024 8:42897386-42897408 TCCCAGCCCAGCCCCGGCCGGGG - Intronic
1040388795 8:46932633-46932655 GGCCAGGCCAGGCCCAGCCCAGG - Intergenic
1040471495 8:47738407-47738429 GCGCAGGCCGGCCCGGGCCGGGG - Exonic
1041673764 8:60517424-60517446 GACCGGGCCTGGCCAGGCCGCGG - Intronic
1042235879 8:66613055-66613077 GCCCCGGCCCGGCCCGGCCAGGG + Exonic
1042235880 8:66613056-66613078 TCCCTGGCCGGGCCGGGCCGGGG - Exonic
1044934162 8:97277524-97277546 CCCCGGGCCGGGCCTGGCCGCGG + Exonic
1044934163 8:97277525-97277547 GCCGCGGCCAGGCCCGGCCCGGG - Exonic
1045145745 8:99341887-99341909 GCGCTGTCCAGGCCAGGCTGCGG - Intronic
1045459066 8:102411698-102411720 GCCCAGCCCAGCCCACCCCGGGG + Intronic
1046748212 8:117898339-117898361 TCCCAGGCAAGGCCAGCCTGGGG + Intronic
1048009360 8:130443615-130443637 GGCCAGGCCAGGCGAGGCGCGGG + Exonic
1048321535 8:133404130-133404152 GGCCAGGCCAGGCCAGACTCTGG + Intergenic
1049090428 8:140510480-140510502 GGCCAGACCAGGGAAGGCCGCGG - Intergenic
1049159579 8:141088849-141088871 CCCCGGGCCAGGCCAGGCCCTGG + Intergenic
1049202160 8:141345752-141345774 GCCAAGGCAGGGCCAGGCCAGGG - Intergenic
1049240945 8:141537088-141537110 GCCCAGGCCAGCCCAGGTGGAGG - Intergenic
1049391764 8:142375293-142375315 GTCCAGCACAGGCCAGGCCCTGG - Intronic
1049405342 8:142449798-142449820 GCCCGGGCCGGGCCAGGACGCGG - Exonic
1049488289 8:142877647-142877669 GCCCAGGGCAGGGAAGGGCGGGG - Intronic
1049531596 8:143158168-143158190 GCCCCAGCCACGCCAGGCTGGGG + Exonic
1049563856 8:143327263-143327285 GCCCAGGAAAAGCCAGGACGCGG + Intronic
1049762215 8:144336718-144336740 GCCCAGGCCGGCGCTGGCCGCGG - Intergenic
1051367534 9:16331806-16331828 GCCCTGGGCACCCCAGGCCGGGG - Intergenic
1052799566 9:32955685-32955707 GCCCAGGCCAGGGCAGTGTGGGG - Intergenic
1053073525 9:35114973-35114995 GCAAGGGCCAGGCCAGGCCCTGG + Intronic
1053283390 9:36835854-36835876 GCCTGGGCCTGGCCTGGCCGTGG + Exonic
1053283391 9:36835855-36835877 CCCACGGCCAGGCCAGGCCCAGG - Exonic
1053431189 9:38042826-38042848 CCCCAGGCCAGGCCAGGCTCTGG + Intronic
1053691290 9:40588656-40588678 GCCAAGGCAAGGCCAGGGCAGGG - Intergenic
1053692393 9:40592934-40592956 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1053789985 9:41679967-41679989 TCGCGGGCCAGGCCAGGCGGAGG - Intergenic
1054155153 9:61634790-61634812 TCGCGGGCCAGGCCAGGCGGAGG + Intergenic
1054273512 9:63048829-63048851 GCCAAGGCAAGGCCAGGGCAGGG + Intergenic
1054302550 9:63389627-63389649 GCCAAGGCAAGGCCAGGGCAGGG - Intergenic
1054303635 9:63393852-63393874 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1054401322 9:64716127-64716149 GCCAAGGCAAGGCCAGGGCAGGG - Intergenic
1054434930 9:65200447-65200469 GCCAAGGCAAGGCCAGGGCAGGG - Intergenic
1054436023 9:65204693-65204715 GCCAAGGCCAGGGCAGGGCAAGG - Intergenic
1054474946 9:65565898-65565920 TCGCGGGCCAGGCCAGGCGGAGG + Intergenic
1054494369 9:65816994-65817016 GCCAAGGCCAGGGCAGGGCAAGG + Intergenic
1054495459 9:65821234-65821256 GCCAAGGCAAGGCCAGGGCAGGG + Intergenic
1054659205 9:67689168-67689190 TCGCGGGCCAGGCCAGGCGGAGG + Intergenic
1055623558 9:78150166-78150188 CCCCAGCCCAGGTCAGGCTGTGG - Intergenic
1057019894 9:91689027-91689049 GTCCAGGCCAGGCCTGCACGGGG + Intronic
1057203225 9:93154747-93154769 GCCCGGGCCAGGCAAACCCGTGG + Intergenic
1057229233 9:93308805-93308827 GGCCAGGCCAGGCCAGGCCAGGG + Intronic
1057246993 9:93464968-93464990 GCCCAGTCCAAGCCAGGCATTGG + Intronic
1057272377 9:93658370-93658392 CCCCGGGCCAAGCCAGGCAGGGG - Intronic
1057277331 9:93682962-93682984 GCTCAGGCTAGGCTAGGCTGGGG - Intergenic
1057522308 9:95769733-95769755 ACCCAGGCCTGGCCAGTCAGAGG + Intergenic
1057726742 9:97573270-97573292 CCCCAGGCCAGACAAGGCCTGGG + Intronic
1057961935 9:99465368-99465390 CACCAGCCCAGGCCAGGCTGAGG - Intergenic
1059389347 9:113989016-113989038 GCCCAGGCCAGAAGAGGCAGGGG - Intronic
1059429310 9:114240536-114240558 ACCCAGGACAGGGCAGGCTGGGG - Intronic
1059651339 9:116318886-116318908 GCCCAGGGCAGGCCCTGCTGAGG - Intronic
1060010881 9:120041852-120041874 GCCCAGCCCATGCCTGGCCTAGG - Intergenic
1060139969 9:121201503-121201525 GGCCAGGCCCCGTCAGGCCGTGG - Intronic
1060173127 9:121477954-121477976 AGCCAGGCCAGGCCAGACCCTGG + Intergenic
1060182930 9:121546274-121546296 GCCCAGGCCTCGCCAGGCCCCGG + Intergenic
1060517606 9:124275740-124275762 GCCTTTGCCAGGCCAGGCCCTGG - Intronic
1060548701 9:124475372-124475394 CCCCAGGCAAGGCCAGGCTGTGG + Intronic
1060597142 9:124855473-124855495 GCCCAGCCCAGGCCAAGGCATGG + Intronic
1060797093 9:126520098-126520120 GCCGGGGCCTGGCCAGGCGGTGG + Intergenic
1060821855 9:126665786-126665808 GGCCAGCCCATGCCAGCCCGGGG + Intronic
1061070997 9:128310705-128310727 GCCAAGTCCAGGCCAGGGCTGGG + Intronic
1061074468 9:128332710-128332732 GCCCAGCACAGGCCAGGACTGGG + Intronic
1061196934 9:129111640-129111662 GGCGGGGCCAGGCCGGGCCGGGG + Intronic
1061217757 9:129231597-129231619 CCCCAAGCCAGGGCAGGCCGCGG - Intergenic
1061414390 9:130438478-130438500 GCCCAAGGCAGACCAGGCCTTGG + Intergenic
1061577804 9:131518551-131518573 GCTCAGGACAGGCCAAGCCACGG - Intronic
1061625689 9:131839379-131839401 GGCCTGGCCAGGACAGGGCGAGG + Intergenic
1061807666 9:133145384-133145406 GCCCAGGCCATGCCGGGGCGGGG - Intronic
1061943270 9:133894249-133894271 TCCCTGGCCAGGCCGGGCCCCGG - Intronic
1062014002 9:134282253-134282275 GCCCCGGCTAAGCCAAGCCGCGG - Intergenic
1062016613 9:134294316-134294338 GCGCCGGCCAGGGAAGGCCGAGG - Intergenic
1062097264 9:134709882-134709904 GCCCAGGGCAGGCAGGGCTGCGG + Intronic
1062440734 9:136568195-136568217 GCCCAGAGCAGGCCAGCCCGGGG + Intergenic
1062565911 9:137163936-137163958 GCCGTGGCCAGGCCGGGCCCTGG - Intronic
1062597350 9:137305289-137305311 GCCCGGGCCAGCACAGGCCGCGG + Intergenic
1187245392 X:17549210-17549232 TGCCAGGCCAGGCCAGGGCCAGG + Intronic
1190278458 X:48914113-48914135 GGCCAGGCCAGGCCAGGCTTAGG + Exonic
1192147212 X:68689658-68689680 GCACAGGCCCAGCCAGGCCCAGG - Intronic
1192529500 X:71872770-71872792 TCCCAGGCCCGGCCTGGCCCAGG + Intergenic
1192795224 X:74420691-74420713 GCCCAGACCCGGCCCGGCCCTGG + Intergenic
1196965112 X:121047428-121047450 AGCCAGGCCCGGCGAGGCCGCGG + Intergenic
1199976602 X:152898135-152898157 GGCCGGGCCGGGCCGGGCCGGGG - Intergenic
1200003002 X:153071881-153071903 GGCAAGGCCAGGCGAGGCCAGGG - Intergenic
1200004721 X:153078128-153078150 GGCAAGGCCAGGCGAGGCCAGGG + Intergenic
1200074449 X:153544199-153544221 GCCCAGCCCAGACGAGGCCCAGG - Intronic
1200136130 X:153875638-153875660 GCCCAGGAAAGGCCAGGGAGAGG + Intronic
1200141164 X:153903811-153903833 GCCCAGCCCAGCCCAGCCCAAGG - Intronic
1200163592 X:154021135-154021157 GACCAGGCAAGGGCAGGCTGAGG - Intergenic