ID: 901870001

View in Genome Browser
Species Human (GRCh38)
Location 1:12132947-12132969
Sequence CTGTCCTCCCAGCTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 485}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901870001_901870006 -8 Left 901870001 1:12132947-12132969 CCATTTTCCAGCTGGGAGGACAG 0: 1
1: 0
2: 4
3: 43
4: 485
Right 901870006 1:12132962-12132984 GAGGACAGAGGCTCGGAGAAGGG 0: 1
1: 0
2: 4
3: 73
4: 647
901870001_901870007 24 Left 901870001 1:12132947-12132969 CCATTTTCCAGCTGGGAGGACAG 0: 1
1: 0
2: 4
3: 43
4: 485
Right 901870007 1:12132994-12133016 TGTGCTGAGTTTCACCGCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 94
901870001_901870005 -9 Left 901870001 1:12132947-12132969 CCATTTTCCAGCTGGGAGGACAG 0: 1
1: 0
2: 4
3: 43
4: 485
Right 901870005 1:12132961-12132983 GGAGGACAGAGGCTCGGAGAAGG 0: 1
1: 0
2: 5
3: 92
4: 752
901870001_901870008 27 Left 901870001 1:12132947-12132969 CCATTTTCCAGCTGGGAGGACAG 0: 1
1: 0
2: 4
3: 43
4: 485
Right 901870008 1:12132997-12133019 GCTGAGTTTCACCGCCAAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901870001 Original CRISPR CTGTCCTCCCAGCTGGAAAA TGG (reversed) Intronic
900837903 1:5020210-5020232 CTCCCCTCTGAGCTGGAAAAGGG + Intergenic
901151265 1:7103281-7103303 CAGTCCTCCCATCCGTAAAATGG - Intronic
901380132 1:8867650-8867672 CTGTAGTCCCAGCAGGAGAATGG - Intronic
901390976 1:8945912-8945934 CTGGCCACCCAGCAGGAACAGGG - Exonic
901749873 1:11399435-11399457 CAGTCCTCTCATCTGTAAAATGG + Intergenic
901753492 1:11426814-11426836 CAGTCTTCCCATCTGTAAAATGG - Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
901916963 1:12507272-12507294 CTGCCCTCCCAGCTGGCCCATGG + Intronic
902115643 1:14118737-14118759 CAGTCTTCCCATCTGTAAAATGG - Intergenic
902181057 1:14688827-14688849 TTGTCCTCTCAGCTGTGAAAGGG - Intronic
902232988 1:15040082-15040104 CAGTCTTCCCACCTGTAAAATGG - Intronic
902627061 1:17682914-17682936 CTCTCCTCCCAACCAGAAAAGGG - Intronic
902702930 1:18184932-18184954 CTGTTTTCTCACCTGGAAAATGG + Intronic
902874215 1:19331331-19331353 CTGTTCTCCCATCTGTAAAATGG - Intergenic
902983525 1:20141891-20141913 CTGTTCTCCCATCTGTAAAATGG - Intronic
903666036 1:25008308-25008330 CTGTCTTCCAAGGAGGAAAACGG + Intergenic
903772121 1:25770568-25770590 CCGTTCTCCCACCTGGGAAATGG + Intronic
904080919 1:27872326-27872348 CAGTGCTCCCAGTTAGAAAAAGG - Intergenic
904329077 1:29746213-29746235 CTTTCCTTCCAGCTGCAGAAGGG - Intergenic
904498317 1:30900175-30900197 CTGTGCCCCCATCTGTAAAATGG + Intronic
904879731 1:33686542-33686564 GTGTGGTCCAAGCTGGAAAATGG - Intronic
906266671 1:44436271-44436293 CTGTCCTCCCAGATTCAGAATGG - Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
907312532 1:53547181-53547203 CAGTCTTCCCATCTGCAAAATGG - Intronic
907334406 1:53690922-53690944 CAGTTGCCCCAGCTGGAAAAAGG - Intronic
907884442 1:58579891-58579913 TTGTCCTCCCATCTGTCAAATGG + Intergenic
909880847 1:80875801-80875823 TTGTACGCCCAGTTGGAAAAGGG - Intergenic
909907565 1:81217793-81217815 CTGTCTTCTCAGTTGTAAAATGG - Intergenic
910340774 1:86184462-86184484 CTCTCCTCCCAGCCAGAAGATGG - Intergenic
912480290 1:109977835-109977857 CTGTCCTCACTGCTGCAGAATGG + Intergenic
912557319 1:110525497-110525519 CTGTCCTGCCAACGGTAAAATGG + Intergenic
912934756 1:113993487-113993509 CTGTTCCTCCAGCTGGAAATGGG - Intergenic
913465115 1:119132528-119132550 CTGTCCTCCCATGGGGAGAATGG - Intronic
914191642 1:145416701-145416723 TTGTCCTCACAGCTAGAAAAAGG + Intergenic
916267160 1:162902271-162902293 CAGTCCTCTCAACTGTAAAATGG - Intergenic
917512066 1:175676949-175676971 CAGTCCTCTCACCTGGAAAATGG - Intronic
918657378 1:187045312-187045334 CTGTACTCCAAGCTGAGAAAAGG - Intergenic
920186383 1:204161849-204161871 CAGGCTTTCCAGCTGGAAAATGG + Intronic
920326740 1:205170835-205170857 CTGTGCTCCAAGCAGGAAGAAGG - Intronic
921385304 1:214562692-214562714 CTGTTCTCCCAGCTACAGAAGGG + Intergenic
921841705 1:219835609-219835631 CTGTCCACCCAACAAGAAAAAGG + Intronic
922230969 1:223685781-223685803 TTTTCCTCCCACCTTGAAAAGGG + Intergenic
922668397 1:227491517-227491539 CTGTTCTCAGAGCAGGAAAATGG - Intergenic
922875814 1:228939147-228939169 CTGTCTTCTCACCTGTAAAATGG - Intergenic
924243633 1:242061766-242061788 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic
924747013 1:246845413-246845435 CTCTGCTCCCAGCTTGTAAATGG + Intronic
1062849347 10:731300-731322 CTCACGTCCCAGCTGGAGAAAGG - Intergenic
1063178330 10:3571806-3571828 CTCTCCTCCCAGTGAGAAAATGG + Intergenic
1065853287 10:29809242-29809264 CTCTCCTCCTGGCTGAAAAATGG - Intergenic
1066430004 10:35342564-35342586 CAGTCTTCCCACCTGTAAAATGG - Intronic
1067209252 10:44244902-44244924 CTGTCCTCCCAGCTAGACTGTGG - Intergenic
1067294829 10:44969594-44969616 CTGTCTTCTCATCTGTAAAATGG + Intronic
1067712161 10:48657970-48657992 CTGTCCTCCCAGGTGGCTGAGGG + Intergenic
1067995870 10:51272656-51272678 ATGTTCACCCAGCTGGGAAAAGG - Intronic
1068071179 10:52197980-52198002 GTGTCCTCCCAGTGGGTAAAAGG - Intronic
1068629394 10:59284391-59284413 CTGTCCTCCCAGCTCCAGCAGGG + Intronic
1069943703 10:71972140-71972162 CTGTCTTCCCATCTGTAAAATGG - Intronic
1070470755 10:76776994-76777016 CTGTCTTCTCATCTGTAAAATGG - Intergenic
1070530927 10:77336817-77336839 CTGTTTTCCCATCTGTAAAATGG + Intronic
1070733230 10:78846053-78846075 CTGTCCTGGAAACTGGAAAAAGG - Intergenic
1070746875 10:78939090-78939112 CTGTCTTCCCAGCCATAAAATGG + Intergenic
1070775932 10:79109783-79109805 CTGTTTTCCCACCTGCAAAATGG + Intronic
1070850852 10:79560490-79560512 CTGTTCTCCAAGCAGGAAATAGG + Intergenic
1071447207 10:85759564-85759586 CTGTCCTCCTGGGTGGTAAAAGG + Intronic
1071494319 10:86157375-86157397 ATGCCCTCCAAGCAGGAAAAGGG + Intronic
1071498391 10:86186620-86186642 CAGTTTTCCCATCTGGAAAATGG + Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1073024828 10:100480261-100480283 TTGGCCTCCCAGCTGGCTAAAGG + Intronic
1074754756 10:116616042-116616064 CTGTTGTCTCAGCTGTAAAATGG + Intergenic
1075016716 10:118915062-118915084 CTGTTTTCCCATCTGTAAAATGG - Intergenic
1075095282 10:119467201-119467223 CTGTTCTCCCAGCGGAAGAAAGG - Intergenic
1075902528 10:126054698-126054720 CTGTCCCCTCATCTGTAAAATGG + Intronic
1075949510 10:126464561-126464583 CTGCTCTCCCAGTTGGAGAAGGG + Intronic
1076162399 10:128255468-128255490 CTGTGCTCTCAGCTGCAAACAGG + Intergenic
1076252536 10:128995679-128995701 CAGTGTTCCCATCTGGAAAATGG + Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077454513 11:2670497-2670519 CTGTCCTCCCAGCTCACAGAAGG + Intronic
1077921208 11:6643046-6643068 CTGAACTACCAGCTGGATAAAGG + Intronic
1078315507 11:10290157-10290179 CTCTTCTCACAGCAGGAAAAGGG - Intronic
1078686212 11:13534659-13534681 CTGTTCACCCCGCTGGAAAGGGG - Intergenic
1078753703 11:14188771-14188793 CTGTCTTCTCATCTGTAAAATGG + Intronic
1078858418 11:15225470-15225492 CTGTCTACCCAGGTGGCAAATGG - Intronic
1079084980 11:17438865-17438887 CAGTCCTCTCTGCTGTAAAATGG + Intronic
1079323612 11:19472973-19472995 CTGTCTTCTCATCTGGAAAATGG - Intronic
1079940317 11:26672411-26672433 CTGTCTTCCCAGCTTGATTAAGG - Intronic
1080551897 11:33379689-33379711 CAGTTCTCTCATCTGGAAAATGG + Intergenic
1080701501 11:34648231-34648253 CAGTCTTCCCACCTGTAAAATGG - Intronic
1080916567 11:36666319-36666341 CTGTCCCAACAGCAGGAAAACGG + Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1081672275 11:44949109-44949131 CTGTTGTCCCATCTGTAAAATGG - Intronic
1081688292 11:45057897-45057919 TGGTCCTCACAGCTGAAAAAGGG - Intergenic
1082002289 11:47399992-47400014 CAGTTATCTCAGCTGGAAAATGG - Intergenic
1082229036 11:49741953-49741975 CTGTCCCATCAGCAGGAAAATGG - Intergenic
1082807175 11:57458685-57458707 CTGTCCTGCCTCCTGGAAATAGG + Intergenic
1084071912 11:66742369-66742391 CTGTCCTCCCTACTGGACATAGG - Intergenic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084213357 11:67633996-67634018 CTGTCCAGGCAGGTGGAAAAGGG - Intronic
1084266410 11:68007662-68007684 CTGCCTTCCCATCTGTAAAATGG - Intergenic
1084422376 11:69066781-69066803 CAGACCCCCCAGCTGGAAGATGG - Intronic
1085205956 11:74731899-74731921 CTGTTTTCCCAGCTTTAAAATGG + Intergenic
1085251711 11:75148246-75148268 CTGTCTTCCCATCTGTTAAATGG - Intronic
1087037059 11:93766353-93766375 CTCTCTTCCCAGAGGGAAAAGGG + Intronic
1087585744 11:100119215-100119237 CTGTATTCTCAGCTGGAAACAGG + Intronic
1087638346 11:100728264-100728286 CTGTGCTCCCACCTGCAAAAGGG + Intronic
1087924717 11:103906462-103906484 GTGTCCACCCAGATGGGAAAAGG + Intergenic
1089292094 11:117443603-117443625 CCCTACTCCCAGCTTGAAAAAGG - Intronic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1089756872 11:120693786-120693808 CAGCCCTCCAAGGTGGAAAATGG - Intronic
1089922860 11:122227409-122227431 CAGTTCTCCTAGCTGTAAAATGG - Intergenic
1090030529 11:123202349-123202371 TCTTCCTCCCAGCTGGACAAGGG + Intergenic
1090292016 11:125553945-125553967 CTGTCCCTTCAGCAGGAAAATGG - Intergenic
1090611069 11:128471259-128471281 GAGTCCTCCCACCTGGAACAGGG + Intronic
1090699880 11:129284147-129284169 CTGTTTTCCCATCTGTAAAATGG + Intergenic
1090711029 11:129385392-129385414 CTGTCCTTTCAGAAGGAAAAAGG + Intronic
1090992470 11:131831425-131831447 ATGTCCTCATGGCTGGAAAATGG + Intronic
1091448861 12:560420-560442 CAGTCTTCTCATCTGGAAAATGG - Intronic
1093500427 12:19805997-19806019 CTCTCCTCCCAACTGAGAAAAGG - Intergenic
1093997043 12:25654100-25654122 CTGGCCTCCCAGCAAGAAAGTGG + Intergenic
1095121841 12:38428328-38428350 CTGTCATCTCAGTTGTAAAATGG + Intergenic
1095334820 12:41011915-41011937 CTGTCCTTCCTTCAGGAAAATGG - Intronic
1095640046 12:44477076-44477098 CTGTCTTATCAGCAGGAAAATGG + Intergenic
1095788140 12:46133510-46133532 CAGTCCTCTCATCTGTAAAATGG - Intergenic
1095804073 12:46299107-46299129 CTGTTTTCCCATCTGTAAAACGG + Intergenic
1096041695 12:48522588-48522610 CTGTACTCCAACCTGGGAAATGG + Intronic
1096590214 12:52653290-52653312 CTGTGGTCCCAGCTATAAAATGG + Intergenic
1098321223 12:69245774-69245796 CTGACCACCCAGCTTTAAAATGG + Intronic
1098458343 12:70702164-70702186 CTTGCCCCCCAGCGGGAAAAGGG - Intronic
1099326833 12:81227151-81227173 CTGACCTCCCAGTAGGAAGAGGG - Intronic
1100537088 12:95521604-95521626 CTGCAGTCCCAGCAGGAAAATGG - Intronic
1100665039 12:96741942-96741964 CAGTTCTCCCAACTGTAAAATGG + Intronic
1100862856 12:98825096-98825118 TTGGCCTCACAGCTGGTAAATGG - Intronic
1100881449 12:99022260-99022282 CTCTCCAACCAGCTGGTAAATGG - Intronic
1101115595 12:101528541-101528563 TTGTTTTCCCAGCTGTAAAATGG + Intergenic
1101559585 12:105843744-105843766 CTGTCCTTGCAAATGGAAAAAGG - Intergenic
1101586050 12:106087050-106087072 CTGTCCCGCCAGGTGGAAAATGG + Intronic
1101764452 12:107685179-107685201 CTGTTTTCCCAGGTGTAAAACGG + Intergenic
1102604076 12:114055365-114055387 TAGTTTTCCCAGCTGGAAAATGG - Intergenic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1102898983 12:116621413-116621435 CAGTCTTCCCATCTGTAAAATGG + Intergenic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1105605506 13:21923530-21923552 CTGTCTTCTCAGCTATAAAATGG - Intergenic
1109466615 13:62742107-62742129 GTCTCCTCCCAGCTAGAACATGG - Intergenic
1109929049 13:69188318-69188340 TTGCCATCTCAGCTGGAAAAAGG + Intergenic
1113839483 13:113350683-113350705 CTGTCCTCCCTGCTGGGAAATGG + Intronic
1114360346 14:21965383-21965405 CTGTCCTACCAATTAGAAAAAGG - Intergenic
1114806756 14:25846558-25846580 CAGTCCTCCCATCTGTAAAATGG + Intergenic
1115641307 14:35337216-35337238 TTGTCCTCATGGCTGGAAAAGGG - Intergenic
1116203235 14:41825763-41825785 CTGAGCTGCCAGCTGGCAAAGGG - Intronic
1117249077 14:53917299-53917321 CTGTCATCCCAGCTAGTCAAAGG - Intergenic
1118325893 14:64780130-64780152 CTGTCCTACCCACTGCAAAAGGG + Intronic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120812280 14:88816366-88816388 CTGTCCTTTCATCTGTAAAATGG + Intergenic
1121033977 14:90683747-90683769 CCGTCCTCTCAGCAGGAACATGG - Intronic
1121775850 14:96590365-96590387 CTGTTTTCCCATCTGTAAAATGG - Intergenic
1122228754 14:100294568-100294590 CTGTCTTCCCATCTTGGAAATGG - Intronic
1122313822 14:100813965-100813987 CTGCCCTCCCAGCAGGCAAAGGG + Intergenic
1122858139 14:104569877-104569899 CTGGCCTCCCACCTGGCAAGTGG + Intronic
1124423374 15:29541387-29541409 CTGTCTTCCCTCCTGGAACATGG - Intronic
1125542052 15:40475285-40475307 CTCTCCTCCCAGGCAGAAAAGGG + Intergenic
1126244292 15:46486110-46486132 TTGTCCCTGCAGCTGGAAAAAGG + Intergenic
1126440163 15:48679088-48679110 CTGTCCGGCCTGCTGGAAATAGG + Intergenic
1128108689 15:65062641-65062663 CTGTGCTACCTGCTGGAAATGGG + Intronic
1128285827 15:66436261-66436283 TTGTCTCCCCAGCTGGAACAAGG + Intronic
1128806644 15:70536089-70536111 CAGTGTTCCCATCTGGAAAAGGG - Intergenic
1129240092 15:74245805-74245827 CGCTGCTCCCAGCTGGAGAAGGG - Intronic
1129673590 15:77620637-77620659 TCGACCTTCCAGCTGGAAAAAGG - Intronic
1129894728 15:79094807-79094829 CAGTCCCCACAGCTGGAAACCGG + Intergenic
1130097204 15:80864596-80864618 CTGTCCGCTCAGTTGTAAAATGG - Intronic
1130127220 15:81104036-81104058 CTATTTTCCCATCTGGAAAATGG - Intronic
1132239086 15:100243917-100243939 CTGTTTTCTCATCTGGAAAATGG - Intronic
1132848390 16:2011706-2011728 CTGTAATCCCAGCTTGAAATTGG + Intronic
1134069582 16:11252615-11252637 CTGTTTTCCCATCTGTAAAACGG + Intronic
1134363360 16:13553442-13553464 CTGTTCTCCCACCTGTAAAATGG - Intergenic
1134385821 16:13771415-13771437 CTGGCCTCCAAGTTGCAAAATGG + Intergenic
1134638751 16:15812250-15812272 CTGTTTTCCCAGCTGTAAAAGGG + Intronic
1134659590 16:15973946-15973968 CTGTCACCCAAGCTGGAATACGG - Intronic
1134687591 16:16169597-16169619 CTCTCCTCCCAGCTGCACCAAGG - Intronic
1134811994 16:17175622-17175644 CTGTCCTCTCTCATGGAAAATGG + Intronic
1135171509 16:20188228-20188250 CAGCCCTCCAAGGTGGAAAATGG - Intergenic
1135257201 16:20950515-20950537 CTGTCTTCCCAGCTGTAAAATGG + Intronic
1135266770 16:21033452-21033474 CTGTTTTCCCAGCTGTAAAATGG - Intronic
1135355211 16:21763311-21763333 CAGTCCCCTCATCTGGAAAATGG - Intergenic
1136024062 16:27458738-27458760 CTGTTCTGGCAGCTGCAAAAGGG + Intergenic
1136068472 16:27774382-27774404 CTGTTTTCCCATCTGTAAAATGG - Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1136514870 16:30762074-30762096 CTGTCCTCCAGGCTGGGAAGTGG + Exonic
1136577139 16:31131583-31131605 CTGTCCTCGAAGCTGCACAAAGG + Exonic
1137691374 16:50430347-50430369 CTGGACTCCCTCCTGGAAAATGG + Intergenic
1137715572 16:50596227-50596249 CTTCCCTCCCAGCTGGAATCAGG + Intronic
1138069046 16:53972401-53972423 CTGTCTCCCCATCTGCAAAATGG + Intronic
1139227678 16:65248958-65248980 CTGTCATCACAGGTAGAAAAGGG + Intergenic
1139355216 16:66363574-66363596 CTGTTTTCCCATCTGTAAAATGG + Intergenic
1139633775 16:68245846-68245868 CTGTCTTTCCAGCTTAAAAATGG - Intronic
1140336352 16:74108518-74108540 CTGTCCCCCAGGCTGGAGAACGG - Intergenic
1140577870 16:76193556-76193578 GTGTCCTCCCACATGGAAAGTGG - Intergenic
1141224502 16:82102169-82102191 CAGTGCTGCCAGCAGGAAAATGG + Intergenic
1141644405 16:85359498-85359520 CTGTCCTCACATCTGTAAGAGGG + Intergenic
1141967638 16:87457412-87457434 CAGTTCTCCCATCTGTAAAATGG + Intronic
1142105009 16:88297942-88297964 CTGTGCTCCCAGCTTGAGGAAGG + Intergenic
1142123819 16:88400374-88400396 CAGTCTCCCCATCTGGAAAATGG - Intergenic
1142482778 17:228969-228991 CAGTCTTCCCATCTGTAAAATGG + Intronic
1142899921 17:3005427-3005449 GTGTCCTACCTTCTGGAAAACGG - Exonic
1143267962 17:5654601-5654623 CTGTCCCCCCATTAGGAAAATGG - Intergenic
1143272621 17:5687008-5687030 GAGTCCCCCCAGCTGTAAAATGG - Intergenic
1143390946 17:6558874-6558896 CTGTCTTCCCATCTGAGAAATGG - Intergenic
1143976734 17:10835852-10835874 CTGTGCTCCTAGCTGCAAAATGG - Intronic
1144013612 17:11172905-11172927 CTGTCCCCCAAGCTGGAATGCGG - Intergenic
1144952198 17:19000360-19000382 CGGTCATCCCATCTGTAAAATGG - Intronic
1145038397 17:19557586-19557608 CTGCCCTCCCAGCTGGCCCATGG + Intronic
1147336513 17:39729707-39729729 GTGTTCTCCAAGCTGGAGAATGG - Exonic
1147952405 17:44114453-44114475 CTGCCCTCCATCCTGGAAAAGGG + Intronic
1148360276 17:47006239-47006261 CTGTCCTTCGAGCTGGCAAGAGG + Intronic
1148669863 17:49402515-49402537 CTGTCCTCCCACCCCCAAAAGGG + Intronic
1148719061 17:49737724-49737746 CTCTCCTGTCAGCTGTAAAAGGG + Intronic
1149854398 17:60067492-60067514 CAGTTCTTCCAGTTGGAAAAGGG - Exonic
1150286173 17:63955493-63955515 CAGTTTTCCCATCTGGAAAACGG - Intronic
1152086992 17:78226324-78226346 CTGTCCTCACAACGGGGAAAAGG - Intergenic
1154167577 18:12027610-12027632 CTGTCCTCCAGGCTGGAATGTGG + Intronic
1155451122 18:25963863-25963885 TTGCCTTCCCAGCTGGGAAAGGG + Intergenic
1156052324 18:32952148-32952170 CTGTCCTCCAAACTCCAAAATGG - Intronic
1156514419 18:37668207-37668229 CTGACCCCCAACCTGGAAAATGG + Intergenic
1157331742 18:46708984-46709006 CAGTTTTCCCATCTGGAAAATGG + Intronic
1158341750 18:56473582-56473604 ATGTCCTCCCTGCTGGGAAATGG - Intergenic
1158395653 18:57076980-57077002 CTGTCTTCTCATCTGTAAAATGG - Intergenic
1158412070 18:57215290-57215312 CTGTTCTTCCATCTGCAAAATGG + Intergenic
1158706962 18:59801460-59801482 CTGTCCCCCAAGCTGGAGTACGG + Intergenic
1160573467 18:79834255-79834277 CTGTCCTCCGACGTGGCAAATGG + Intergenic
1160618176 18:80149775-80149797 CAGTGCTACCAGTTGGAAAAAGG + Intronic
1160866860 19:1260045-1260067 CTGTTCTCCCATCTATAAAATGG - Intronic
1160967114 19:1751621-1751643 CTCTCTTCCCACCTGGAAGATGG + Intergenic
1161359577 19:3840128-3840150 CTGTCCTCCTACCTGGACAAAGG + Intronic
1161449299 19:4335736-4335758 CTGTTTCCCCAGCTGTAAAATGG + Intronic
1161538435 19:4834446-4834468 CTGTTCTCTCATCTGTAAAATGG - Intergenic
1161814899 19:6494111-6494133 CGGTCTTCCCACCTGTAAAATGG - Intergenic
1162577718 19:11508420-11508442 CTGTCATCCATGCTGGAGAATGG + Intronic
1163185968 19:15640087-15640109 CAGTCTTCCCATCTGGGAAATGG - Intronic
1163211324 19:15842475-15842497 CTGTGCTCACAGCTGCAAAGAGG + Intergenic
1163420550 19:17211633-17211655 ATGTCCTCCCTGGAGGAAAAAGG - Exonic
1163599753 19:18241857-18241879 TTGTTTTCCCAGCAGGAAAATGG - Intronic
1163720066 19:18894607-18894629 CGGGCTTCCCAGCTGGAAACTGG + Intronic
1163804740 19:19388608-19388630 ATGGCCTCACGGCTGGAAAATGG - Intronic
1163987206 19:20964829-20964851 CTGTCCTCCAAGCTGGCAGAAGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165829857 19:38725042-38725064 CTGTCCTCCCAGCTCTAAAATGG + Intronic
1165929917 19:39350787-39350809 CTGCACTCCCACCTGGAGAAAGG - Intronic
1165953183 19:39486175-39486197 CTGTCTTCCCAGCTGGCCACTGG + Exonic
1166009858 19:39934374-39934396 CTGTGCTCCCATCCAGAAAAGGG + Intronic
1166112009 19:40628172-40628194 CAGTCTTCCCACCTGTAAAATGG + Intronic
1166942148 19:46373720-46373742 CTGTCCACCCCGCTGGAAGGTGG - Intronic
1167560001 19:50221243-50221265 CTGTTTTCCCATCTGAAAAATGG - Intronic
1167570210 19:50282218-50282240 CAGTTCGCCCATCTGGAAAATGG + Intronic
925616561 2:5749261-5749283 CTGAACTCCCAGCAGGAGAAAGG + Intergenic
925736999 2:6972331-6972353 CTTTCCTCCTAGCTACAAAAGGG + Intronic
926787359 2:16531319-16531341 CTGTCCTGCCTGCTGGTGAAAGG + Intergenic
927377168 2:22431647-22431669 TTGTCTTCCCATCTGAAAAATGG + Intergenic
927514956 2:23666838-23666860 CTGTCCTCCCAGCAGCTATAAGG + Intronic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929103972 2:38345838-38345860 CTGTTTTCTCATCTGGAAAATGG + Intronic
929205781 2:39290954-39290976 CTGTAGTCCCAGCAGGAGAATGG + Intronic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
930925312 2:56810934-56810956 CTGTCCACCCACATAGAAAACGG + Intergenic
931173561 2:59830397-59830419 CTGTTCTCCCATCTATAAAATGG - Intergenic
931279121 2:60772766-60772788 CTGTCCTCTTAGTTGGAAAAGGG + Intronic
931538194 2:63301280-63301302 CTGTCCCATCAGCAGGAAAATGG + Intronic
931633652 2:64323028-64323050 CAGTCCCACCAGCTGCAAAATGG + Intergenic
932816524 2:74866302-74866324 CTGTTCTCCCACCAGGAAAGGGG + Intronic
933585802 2:84178221-84178243 CTGTCCTCCCACCTAGTAAGTGG + Intergenic
933941592 2:87249570-87249592 CCGTGCTCCCAGCTGCAACATGG - Intergenic
935307733 2:101753928-101753950 CTGTCCACCCTTCTGGACAAGGG - Intronic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
936517778 2:113193086-113193108 CTGGCCTCCAAACTGGAAGAAGG - Exonic
938090731 2:128432939-128432961 CTGTCCCCCAAGCTGGAGTATGG + Intergenic
939873512 2:147550729-147550751 CTCTCCTCCTAGGTGGAGAATGG - Intergenic
939953000 2:148497960-148497982 CAGTTCTCCCATCTGTAAAATGG - Intronic
941149364 2:161894758-161894780 CTGTTCTCCCTCCTGGAGAATGG + Exonic
944656341 2:201880056-201880078 CTGGCCTCCCAGATGCTAAAAGG + Exonic
944936127 2:204570458-204570480 CTGTCCATCTAGCTGGAATAGGG + Intronic
946422569 2:219572793-219572815 CTGTCTCCCCATCTGTAAAATGG + Intronic
947681445 2:232037523-232037545 CTGTTCACCCCGCTGGAAAAGGG - Intronic
948182366 2:235992323-235992345 CAGTGCTCTCAGCTGTAAAATGG + Intronic
948486239 2:238283073-238283095 CTGTCCTGCCTGCTGCCAAAGGG + Intronic
1169263269 20:4152787-4152809 CAGTCTTCCCAGCTGTAAAATGG - Intronic
1169434427 20:5573116-5573138 CTGTCATCCAGGCTGGAAAACGG + Intronic
1169554859 20:6738499-6738521 CTGTCTTCCCAACTGGAGATAGG + Intergenic
1169848709 20:10026052-10026074 ATGACCTCCCAGGTGGGAAATGG + Intronic
1169886440 20:10403660-10403682 CTGTCCACAAAGCTGGGAAATGG + Exonic
1170538239 20:17362939-17362961 CTGTCCTCACAGCTAGAACCGGG + Intronic
1172086503 20:32388209-32388231 CTGTCACCCCAGCTGGAATGCGG + Intronic
1172126172 20:32626626-32626648 CAGTCTCCCCATCTGGAAAATGG + Intergenic
1172188966 20:33050081-33050103 CAGTTCTCCCATCTGCAAAATGG - Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1174037708 20:47678473-47678495 CTGTCTTCCCATCTGGAATGTGG - Intronic
1174490017 20:50886281-50886303 CTGACATCTCAGCTGGCAAAGGG - Intergenic
1174586436 20:51612158-51612180 CGGTCTTCCCACCTGGAAAACGG - Intronic
1174654256 20:52157202-52157224 ATGTTCTCTCAGCTGGACAAAGG + Intronic
1175220529 20:57414148-57414170 CTGTCTTCCCCTCTGTAAAATGG - Intergenic
1175301076 20:57943175-57943197 CAGTCCTCTCAGCTGTAAAATGG - Intergenic
1175737166 20:61395058-61395080 CTGTCCTCCCAGGAGGAGAGTGG - Intronic
1176049852 20:63112966-63112988 CAGTCCCTCCATCTGGAAAATGG - Intergenic
1176295189 21:5068253-5068275 CTGTCATCCCAGCTGGAGTGCGG + Intergenic
1176964572 21:15197431-15197453 CAGTTTTCCCAGCTGTAAAATGG + Intergenic
1178280580 21:31279002-31279024 CTGTCCTTCCACCTGCACAACGG + Intronic
1178798921 21:35773494-35773516 CTGTCCTTCAAGCTGGAACATGG - Intronic
1179437574 21:41373024-41373046 CTGTCTCCCCAGCTGCAATAAGG - Intronic
1179861860 21:44193875-44193897 CTGTCATCCCAGCTGGAGTGCGG - Intergenic
1181275294 22:21684168-21684190 CTGTCGCCCCAGCTAGAAAGCGG - Intronic
1182005799 22:26958571-26958593 CAGTCTTCCCACCTGTAAAATGG + Intergenic
1182109814 22:27715195-27715217 CTGCCTTCCCAGCTGGACGAGGG - Intergenic
1182458927 22:30470666-30470688 CTTTCCTCCCACATGCAAAATGG + Intronic
1182805769 22:33068866-33068888 TTGGCCTCCAAGATGGAAAAGGG + Intergenic
1182870987 22:33647440-33647462 CTTTCCTGCCAGCTGGAATGTGG + Intronic
1183265570 22:36823202-36823224 CTGGCCTCCCAGCTGGTGGAGGG + Intergenic
1183275334 22:36892890-36892912 CTGTCTTCCCATCTGTAAAATGG + Intergenic
1183376083 22:37466267-37466289 CTGGCCTCTCATCTGTAAAATGG - Intergenic
1183394324 22:37562570-37562592 CGGTCTTCCCATGTGGAAAACGG - Intronic
1183452333 22:37903889-37903911 CTGTAATCCCAGCAGGAGAATGG - Intergenic
1184430160 22:44437862-44437884 CTGCCCTCTCTGCTGCAAAATGG - Intergenic
1184541524 22:45128762-45128784 CTGACCTCCCAGAAGGAAGAGGG - Intergenic
1184586309 22:45450417-45450439 CTGTTTCCCCAGCTGTAAAATGG + Intergenic
1184857807 22:47156082-47156104 CTGTCCTCCCAGATGGCTGAAGG + Intronic
1185024517 22:48400646-48400668 CTGTCTTCCCAGCTGGGTCATGG + Intergenic
1185127765 22:49021354-49021376 AGGTCCTCCCAGCAGGAGAAGGG - Intergenic
1185314740 22:50174191-50174213 CTGTCCTCCCACCTGGGGAGTGG - Intronic
950490320 3:13300701-13300723 CAGTCTTCCCATCTGTAAAAGGG - Intergenic
950551370 3:13668221-13668243 CGGTCCCCCCACCTGGAAATGGG - Intergenic
950642264 3:14356009-14356031 TAGTCTTCCCACCTGGAAAATGG - Intergenic
950672745 3:14536995-14537017 CAGTTTTCCCAGCTGTAAAATGG - Intronic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
950712996 3:14827108-14827130 CTGTTTTCTCACCTGGAAAATGG - Intronic
951427157 3:22560897-22560919 CTATCCTCCCAGGTAAAAAACGG - Intergenic
953023445 3:39130555-39130577 CACTCCTCCCAGCTGGCACAGGG - Intronic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953911865 3:46897276-46897298 CTGTCAGCCCATCTGGAAAATGG + Intronic
954070843 3:48141776-48141798 CTGTCTGTCCATCTGGAAAATGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957289222 3:78256733-78256755 ATCTCCTACCAGTTGGAAAATGG - Intergenic
958631338 3:96686901-96686923 CTCTCCTCCCAGCTGCCAAGTGG + Intergenic
958952461 3:100431108-100431130 CTGTTCTCACATCTGGAAACTGG - Intronic
961057563 3:123802188-123802210 CAGTCTTCCCAGCTGTGAAATGG + Intronic
961438798 3:126938361-126938383 CTGTCTTCTCAGCTGTAAGATGG + Intronic
962190170 3:133302016-133302038 CAGTGCTCCCACCTGTAAAATGG + Intronic
962950829 3:140216978-140217000 CTGTTCTCTCATCTGTAAAATGG - Intronic
963045771 3:141101541-141101563 CTGTCTTCCCATCTGTAAAATGG + Intronic
963106480 3:141651904-141651926 CTGACCTCCCAGCTGAAAGAAGG - Intergenic
964105324 3:153033664-153033686 CTGTCATCCAAGCTGGAATGCGG + Intergenic
964510458 3:157444600-157444622 TTGAACTCCCAGCTGGAAGAAGG + Intronic
964807067 3:160621995-160622017 CAGTCTTCCCAGCTATAAAATGG + Intergenic
965162311 3:165150109-165150131 CTGTAGTCCCAGCAGGAGAATGG - Intergenic
965351416 3:167616165-167616187 CTATCCTTGCAGCTGGTAAAGGG + Intronic
965411227 3:168334304-168334326 CTTTTCTCCCATCTGTAAAATGG + Intergenic
966243694 3:177782315-177782337 CTGTTTTCTCAGCTGCAAAATGG + Intergenic
966539815 3:181076795-181076817 TTGTCCTCCCTGCTAGAGAAGGG + Intergenic
966909670 3:184551979-184552001 CTGTCTCCTCACCTGGAAAATGG - Intronic
967620041 3:191621937-191621959 CTGTCTTCTGAGCTGTAAAATGG - Intergenic
967847457 3:194055440-194055462 CTCTTTTCCCAGCTGTAAAATGG - Intergenic
968131797 3:196196556-196196578 CTGACCTCCCACCAGGAAAGAGG + Intergenic
969065751 4:4479234-4479256 CTGTCTTCTCATCTGCAAAAGGG - Intronic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969299756 4:6290999-6291021 CTGGCCTCCCAGCTGGAGAGTGG + Intronic
969354299 4:6616275-6616297 CGGTCTTCCCATCTGTAAAACGG + Intronic
969475036 4:7417566-7417588 CTGTTCTCCCACCTTTAAAACGG + Intronic
969481110 4:7447425-7447447 CAGTGTTCCCATCTGGAAAATGG - Intronic
970242431 4:14023369-14023391 CTCTCCTCCCAGGTGGAATGGGG + Intergenic
970585047 4:17507273-17507295 TTGTCTTCACAGCTGTAAAATGG + Intronic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
972786870 4:42334534-42334556 CTTTTCTCCCAGCTGGATGAAGG + Intergenic
974140294 4:57878157-57878179 CAGTTTTCCCAGCTGTAAAATGG + Intergenic
974695074 4:65356910-65356932 CTGTACTTCAAGCTGGATAATGG - Intronic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
976564256 4:86535440-86535462 CTGTCATCCCAGCTGGACTGCGG + Intronic
976646287 4:87390716-87390738 ATGCCCTCCCATCTGCAAAATGG + Intronic
977662717 4:99609513-99609535 CTGTCCTCCCAAATGCAAAGTGG + Intronic
977721592 4:100245329-100245351 CTGTCCAACCAGCTATAAAATGG - Intergenic
977724300 4:100277108-100277130 CAGTCCTTCTTGCTGGAAAATGG + Intergenic
978019113 4:103786441-103786463 CTGTCCCATCAGCAGGAAAATGG + Intergenic
978385577 4:108172833-108172855 CTCGCCTCCCAGCTGGCAGAAGG - Intergenic
979307691 4:119166470-119166492 CTGTACTCCCACCTGGGCAATGG + Intronic
979593819 4:122510935-122510957 CTGTTTTCCCATCTGCAAAATGG + Intergenic
980642312 4:135596548-135596570 CTGTCCCATCAGCAGGAAAATGG + Intergenic
981631917 4:146829223-146829245 CTGTTTTCCCAGTTGGAAACTGG - Intronic
982316367 4:154036065-154036087 CTGTCCTCCCACCTGGAATGTGG + Intergenic
982716333 4:158812334-158812356 CTATCTACCCGGCTGGAAAAAGG - Intronic
984087693 4:175332699-175332721 GCTTCCTCTCAGCTGGAAAACGG + Intergenic
984392072 4:179148774-179148796 CTGTCAGCCCAGCTGTATAAGGG + Intergenic
984996745 4:185439338-185439360 ATGTCCTACAAGCTGGAGAAAGG + Intronic
986402353 5:7394542-7394564 CTGTCCTCCTCGCTGGCAGAGGG - Intergenic
987314341 5:16710359-16710381 CTCTGCTCCTATCTGGAAAAGGG + Intronic
990110658 5:52319014-52319036 CTGTTCTCCCATCGGGAAAGTGG + Intergenic
991359080 5:65801693-65801715 CTGTCTCCCCAGCTACAAAATGG + Intronic
991497055 5:67236899-67236921 CTGTTCTCCCTGCTGGACAGTGG + Intergenic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
995319061 5:110810989-110811011 CTGCCCACCATGCTGGAAAATGG - Intergenic
997492417 5:134288786-134288808 CAGTTTTCCCAGCTGGATAATGG - Intronic
997619133 5:135273326-135273348 CAGCCCTCCCCGCTGGACAAGGG - Intronic
998554390 5:143108993-143109015 CTGTCCTTTCATCTGTAAAATGG + Intronic
998608997 5:143667276-143667298 CTGTTTTCTCAGCTGCAAAATGG - Intergenic
999102630 5:149038963-149038985 CAGTCTCCCCAACTGGAAAATGG + Intronic
999128384 5:149264005-149264027 CTGTTCTACCTGATGGAAAAGGG + Intergenic
999762609 5:154714069-154714091 CAGTTTTCCCAGCTGCAAAATGG + Intronic
1001544954 5:172565313-172565335 CTGTTTTCCCATCTGTAAAATGG + Intergenic
1001801024 5:174544207-174544229 CTGTCCTCCCATCGGTAAAATGG - Intergenic
1002434863 5:179225038-179225060 CTGTCCTTCAAGGTGGGAAAGGG - Intronic
1002671336 5:180870187-180870209 CTGTTCCCCCATCTGTAAAATGG - Intergenic
1002871315 6:1169663-1169685 CTGTCCTCTCATCTGTAAAGTGG - Intergenic
1005695001 6:28343646-28343668 CTGTAGTCCCAGCAGGAGAATGG - Intronic
1005938547 6:30543809-30543831 CTATAATCCCATCTGGAAAAAGG + Exonic
1006441385 6:34055820-34055842 CGGTTCTCCCATCTGTAAAATGG + Intronic
1006447617 6:34088711-34088733 CAGTTCTCCCATCTGCAAAATGG + Intronic
1009657756 6:66568244-66568266 CTGTCCTTTCAGCAGGAAAATGG - Intergenic
1009810039 6:68650187-68650209 CTGTGCGCCCATCTGCAAAAGGG - Intronic
1010212783 6:73375258-73375280 CTGTTCTCTCAGCTGGGAAAAGG - Intronic
1011194751 6:84769243-84769265 CCTTTCTCCAAGCTGGAAAACGG - Intergenic
1011603246 6:89079328-89079350 CTGTTTCCCCAGCTGTAAAATGG + Intergenic
1011637291 6:89386148-89386170 ATTTCCCCCCAGCTGCAAAAGGG + Intronic
1011672194 6:89694125-89694147 CTGTCATCCCAGCTGCAGACTGG - Exonic
1011856235 6:91694935-91694957 CTCTGATCCCAGCTGGAACAAGG - Intergenic
1012953850 6:105547439-105547461 CTGTTTTCCCATCTGTAAAATGG + Intergenic
1013103812 6:107009735-107009757 CTGTCCTCCCATCTGGGGAAGGG - Intergenic
1013176520 6:107682153-107682175 CTGCGCTCCAACCTGGAAAACGG - Intergenic
1013667171 6:112360707-112360729 GGGTCAGCCCAGCTGGAAAAAGG + Intergenic
1013812008 6:114055502-114055524 CTGTACTCTCAGCTTGAAACAGG - Intergenic
1013875754 6:114825651-114825673 AGGACCTCCCAGCTGCAAAATGG + Intergenic
1014831936 6:126112996-126113018 CTGTCCACTCAGATGCAAAAAGG - Intergenic
1015007791 6:128304788-128304810 CTGTCTTCCTAGCTGGACTAGGG - Intronic
1018398658 6:163401214-163401236 CAGTCTTCTCAGCTGCAAAATGG - Intergenic
1018742009 6:166736761-166736783 CTCTCCTCTCAGCTGGAAGCAGG + Intronic
1018992800 6:168686883-168686905 ATGTCCTTCCAGCTGAAAACAGG + Intergenic
1019020186 6:168911613-168911635 CTGCCCTCCCAGGTGGGAAGCGG + Intergenic
1019339061 7:499741-499763 CTGTGCTCCAGGCTGGAAGAAGG - Intronic
1019361806 7:608771-608793 CTGTCCTCCCACCTGGGGAGGGG + Intronic
1019361831 7:608836-608858 CTGTCCTCCCACCTGGGGAGGGG + Intronic
1019361855 7:608901-608923 CTGTCCTCCCACCTGGGGAGGGG + Intronic
1019361880 7:608966-608988 CTGTCCTCCCACCTGGGGAGGGG + Intronic
1019361905 7:609031-609053 CTGTCCTCCCACCTGGGGAGGGG + Intronic
1019422385 7:957081-957103 CAGTCTTCCCAGCTGAAAATGGG - Intronic
1019533054 7:1513231-1513253 CAGTTCCCCCACCTGGAAAATGG + Intergenic
1019586829 7:1809683-1809705 CAGTCTTCGCATCTGGAAAACGG - Intergenic
1020255805 7:6502650-6502672 CTCTCCTCCTAGCAGGAAAAGGG - Intronic
1022222673 7:28329383-28329405 CTGGCCTTCCAGCTGCAGAATGG + Intronic
1022251193 7:28610213-28610235 CTGTTCACCCAGCTGGCAGAGGG - Intronic
1022508334 7:30920623-30920645 CAGTCTTCCCATCTGCAAAATGG - Intronic
1022573620 7:31476642-31476664 CTGTTTTCTCAGCTGTAAAATGG - Intergenic
1022614610 7:31916521-31916543 CTGTTCTCACACCAGGAAAATGG - Intronic
1023282485 7:38585333-38585355 ATGTCCTGCCAACTGGAGAAAGG - Intronic
1023339521 7:39205137-39205159 CTGTCCTCCGAGATGGACTACGG - Intronic
1024097049 7:45990518-45990540 CTGTCCTCCTAACAGGAGAATGG + Intergenic
1024481209 7:49865357-49865379 CAGTTTTCCCAGCTGAAAAATGG + Intronic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1027453606 7:78360707-78360729 CTGTCCCTCCTGCTGGAAGAGGG - Intronic
1028351707 7:89857639-89857661 CTGTCCCATCAGCAGGAAAACGG + Intergenic
1028619455 7:92808744-92808766 CTATCCTCCCAGCTGAAAATGGG - Intronic
1029568234 7:101353850-101353872 CTGTCTTCCCATCTGTAAAATGG + Intergenic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1029687706 7:102160140-102160162 CTGTCATCCAAGCTGGAGTATGG - Intronic
1030684003 7:112464802-112464824 CTGTCCGCTCAGCTGGGGAATGG - Intronic
1032110285 7:129069993-129070015 CTGTCACCCAAGCTGGACAATGG + Intergenic
1032977066 7:137237673-137237695 ATGTCCTCCCAGCTGTAAGCAGG + Intronic
1033234758 7:139629521-139629543 CTGTTTCCCCATCTGGAAAATGG - Intronic
1034118910 7:148609568-148609590 CTGTCCTCCTAGGTGTAAAGTGG + Intronic
1034155824 7:148955312-148955334 ATGGCTTTCCAGCTGGAAAAGGG - Intergenic
1034239492 7:149598938-149598960 CTGTCTTCACTGCAGGAAAAAGG + Intergenic
1034462042 7:151203387-151203409 GTGTCCTCCCAGAAGGTAAACGG - Exonic
1034965677 7:155389197-155389219 CTGTCCTCTCCACTGTAAAATGG - Intronic
1037772539 8:21810949-21810971 CTGACCTCCCATCAGGGAAAGGG + Intronic
1038264759 8:26029946-26029968 CTGTCATCCAGGCTGGAATATGG + Intronic
1038300666 8:26344012-26344034 CTGGGCCCCCAGCTGGCAAAAGG - Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038985204 8:32801453-32801475 CTGTCCTCCCATCCTTAAAACGG + Intergenic
1039259659 8:35757514-35757536 CTGTCCTCCCATCTGGGTCAGGG + Intronic
1039895872 8:41716099-41716121 CAGCCCTCCCATCTGTAAAATGG + Intronic
1040454231 8:47579885-47579907 CTGTCCTCCCTCCTGGGAGATGG + Intronic
1040866944 8:52057062-52057084 CTGTCCTCCCAACTGTAAAATGG - Intergenic
1040892107 8:52327983-52328005 CTGATATCCCATCTGGAAAATGG + Intronic
1041568929 8:59313672-59313694 CTCTACTCCAGGCTGGAAAATGG - Intergenic
1041748378 8:61233705-61233727 CTGCCCTCCTGGCTGGGAAAAGG + Intronic
1043342101 8:79252311-79252333 CTATGTTCCCATCTGGAAAATGG + Intergenic
1044271351 8:90248051-90248073 GCTTCCTCCAAGCTGGAAAAAGG - Intergenic
1044841249 8:96338879-96338901 CTGGCCTCAGAGCTGGCAAATGG + Intergenic
1045294829 8:100863720-100863742 CAGGACTCCTAGCTGGAAAAGGG + Intergenic
1045892087 8:107169305-107169327 CTTCCCATCCAGCTGGAAAATGG - Intergenic
1047995482 8:130331035-130331057 CAGTTCCCCCAGCTGCAAAAAGG + Intronic
1048003606 8:130400424-130400446 CAGTATTCCCAGCTGCAAAATGG + Intronic
1048282528 8:133115639-133115661 CTGTCTTCCCAGCTGAGAAGTGG - Intronic
1048290442 8:133177294-133177316 CTGTTTTCACAGCTGTAAAATGG + Intergenic
1049242170 8:141543602-141543624 CTGTCTTCCCCGCTGGACAGAGG - Intergenic
1049362108 8:142216746-142216768 CTGTCCTCATATCTGTAAAATGG + Intronic
1049408332 8:142461505-142461527 CGGTCATCCCACCTGGAAACTGG - Intronic
1049965341 9:774514-774536 CTGTCGTCCCAGCTGGAGTACGG + Intergenic
1051139139 9:13959240-13959262 CAGTACTCTCAGCTGTAAAATGG + Intergenic
1051824315 9:21201999-21202021 CTGTCCTTCAAGCAGGAGAAAGG + Exonic
1052294135 9:26878776-26878798 CTGTCCCCCAAGCTGGAGTACGG - Intronic
1053347991 9:37392247-37392269 CAGTCCTCACAGCTGGACATGGG + Intergenic
1053359051 9:37470250-37470272 CTGTCATCCAAGCTGGAGTACGG + Intergenic
1055869282 9:80855042-80855064 ATGCCCTCCCACCTGGAAAGGGG - Intergenic
1056760903 9:89414427-89414449 CTTCCCTCCCAGCTGGAAGCAGG + Intronic
1057008501 9:91581703-91581725 CTATCCTGCCATCTAGAAAAGGG + Intronic
1057691688 9:97291696-97291718 CAATTTTCCCAGCTGGAAAATGG - Intergenic
1059413560 9:114149386-114149408 CAGTGCTCACATCTGGAAAATGG + Intergenic
1059513788 9:114874425-114874447 CTGTTTTCCCATCTGTAAAATGG - Intergenic
1059754444 9:117279481-117279503 CTGTCTTCTCAACTGTAAAATGG - Intronic
1060014145 9:120071753-120071775 CTGTCCTCTCATCTGTAAGATGG - Intergenic
1060367781 9:123035926-123035948 CAGTCATGCCAGCTGGAAAGAGG - Intronic
1060972737 9:127748138-127748160 CTTTCCTCCAACCTGGAGAATGG + Intronic
1061017276 9:127989179-127989201 CTGGCCTCCCAGCTGAAGGAGGG - Intergenic
1061249033 9:129415801-129415823 CAGTCTTCCCATCTGGCAAATGG + Intergenic
1061254006 9:129443201-129443223 CTGTGCCCCCAGCTGGGAGAAGG + Intergenic
1061324362 9:129854121-129854143 CTTTCCGCCCATCTGCAAAATGG - Intronic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1061630053 9:131866648-131866670 CAGTTTTCCCATCTGGAAAATGG + Intronic
1061643833 9:131982591-131982613 CTGTTTTCCCATCTGTAAAATGG - Intronic
1061663711 9:132148043-132148065 CAGTCTTCCCATCTGCAAAATGG - Intergenic
1062306468 9:135909687-135909709 CTGTAATCCCAGCTAAAAAAGGG + Intergenic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1187731931 X:22264197-22264219 CTGCCCTCCCATCTGGCCAAGGG - Intergenic
1190416482 X:50184989-50185011 CTGTCATCTCATCTGCAAAAAGG + Intergenic
1190893856 X:54596940-54596962 CTGCCCTCCCCTCTGGCAAAGGG + Intergenic
1191920857 X:66255526-66255548 CTGTTTTCTCATCTGGAAAATGG + Intronic
1193790807 X:85813405-85813427 CTGTCCCATCAGCAGGAAAATGG + Intergenic
1195385154 X:104307015-104307037 CTGTTTTCCCATTTGGAAAATGG + Intergenic
1197216193 X:123868693-123868715 CTGTCCCCCAAGCTGGAATGGGG - Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1197717614 X:129720637-129720659 CTGTTCCCTCATCTGGAAAATGG - Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1199342187 X:146694053-146694075 CTGGCATCCAAGTTGGAAAATGG - Intergenic
1200961624 Y:9001314-9001336 CTGGCCTCACATCAGGAAAATGG - Intergenic
1201758564 Y:17515301-17515323 CTGTTCTCAGAGCAGGAAAAGGG - Intergenic
1201793018 Y:17862971-17862993 CTGTCCTCCTATCAGGAACATGG - Intergenic
1201808536 Y:18043015-18043037 CTGTCCTCCTATCAGGAACATGG + Intergenic
1201842991 Y:18390689-18390711 CTGTTCTCAGAGCAGGAAAAGGG + Intergenic
1202151155 Y:21844925-21844947 CTGGCCTCACATCGGGAAAATGG + Intergenic
1202590662 Y:26479886-26479908 CTGCGCTCCAACCTGGAAAACGG + Intergenic