ID: 901875155

View in Genome Browser
Species Human (GRCh38)
Location 1:12163250-12163272
Sequence CCAGCTAATACGGGGTACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901875155_901875161 10 Left 901875155 1:12163250-12163272 CCGCTGTACCCCGTATTAGCTGG No data
Right 901875161 1:12163283-12163305 CATAAAGCTTGCCCCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901875155 Original CRISPR CCAGCTAATACGGGGTACAG CGG (reversed) Intergenic
No off target data available for this crispr