ID: 901875264

View in Genome Browser
Species Human (GRCh38)
Location 1:12163890-12163912
Sequence TTTTGGGTGGTCGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901875264_901875269 5 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875269 1:12163918-12163940 CCAGACATTGCCAAATGTGCTGG No data
901875264_901875276 17 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875276 1:12163930-12163952 AAATGTGCTGGGGAGGGAGAGGG No data
901875264_901875272 10 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875272 1:12163923-12163945 CATTGCCAAATGTGCTGGGGAGG No data
901875264_901875275 16 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875275 1:12163929-12163951 CAAATGTGCTGGGGAGGGAGAGG No data
901875264_901875270 6 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875270 1:12163919-12163941 CAGACATTGCCAAATGTGCTGGG No data
901875264_901875273 11 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875273 1:12163924-12163946 ATTGCCAAATGTGCTGGGGAGGG No data
901875264_901875271 7 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875271 1:12163920-12163942 AGACATTGCCAAATGTGCTGGGG No data
901875264_901875278 19 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875278 1:12163932-12163954 ATGTGCTGGGGAGGGAGAGGGGG No data
901875264_901875277 18 Left 901875264 1:12163890-12163912 CCTGCAGCTGCGACCACCCAAAA No data
Right 901875277 1:12163931-12163953 AATGTGCTGGGGAGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901875264 Original CRISPR TTTTGGGTGGTCGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr