ID: 901875326

View in Genome Browser
Species Human (GRCh38)
Location 1:12164163-12164185
Sequence CAGGGACAGCAGAGGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901875326_901875330 0 Left 901875326 1:12164163-12164185 CCACACTGCCTCTGCTGTCCCTG No data
Right 901875330 1:12164186-12164208 AGTTTTACCATATTCCCCAGTGG No data
901875326_901875331 4 Left 901875326 1:12164163-12164185 CCACACTGCCTCTGCTGTCCCTG No data
Right 901875331 1:12164190-12164212 TTACCATATTCCCCAGTGGCAGG No data
901875326_901875334 14 Left 901875326 1:12164163-12164185 CCACACTGCCTCTGCTGTCCCTG No data
Right 901875334 1:12164200-12164222 CCCCAGTGGCAGGTACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901875326 Original CRISPR CAGGGACAGCAGAGGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr