ID: 901875996

View in Genome Browser
Species Human (GRCh38)
Location 1:12167356-12167378
Sequence GGCCCGGCACACGTGCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901875988_901875996 3 Left 901875988 1:12167330-12167352 CCTCTGGGGACCCGCTGGGGACT 0: 1
1: 0
2: 2
3: 21
4: 178
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875981_901875996 21 Left 901875981 1:12167312-12167334 CCGCATCAGACACGCGCGCCTCT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875993_901875996 -8 Left 901875993 1:12167341-12167363 CCGCTGGGGACTCCGGGCCCGGC 0: 1
1: 0
2: 5
3: 20
4: 227
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875977_901875996 28 Left 901875977 1:12167305-12167327 CCCCCATCCGCATCAGACACGCG 0: 1
1: 0
2: 0
3: 5
4: 37
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875979_901875996 26 Left 901875979 1:12167307-12167329 CCCATCCGCATCAGACACGCGCG 0: 1
1: 0
2: 0
3: 0
4: 15
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875978_901875996 27 Left 901875978 1:12167306-12167328 CCCCATCCGCATCAGACACGCGC 0: 1
1: 0
2: 0
3: 1
4: 30
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875976_901875996 29 Left 901875976 1:12167304-12167326 CCCCCCATCCGCATCAGACACGC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875991_901875996 -7 Left 901875991 1:12167340-12167362 CCCGCTGGGGACTCCGGGCCCGG 0: 1
1: 0
2: 6
3: 20
4: 268
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82
901875980_901875996 25 Left 901875980 1:12167308-12167330 CCATCCGCATCAGACACGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 901875996 1:12167356-12167378 GGCCCGGCACACGTGCGCTCGGG 0: 1
1: 0
2: 1
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901875996 Original CRISPR GGCCCGGCACACGTGCGCTC GGG Intronic