ID: 901877396

View in Genome Browser
Species Human (GRCh38)
Location 1:12174740-12174762
Sequence TGCCCACTAGTGTCCAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901877396_901877401 26 Left 901877396 1:12174740-12174762 CCTCTTTTGGACACTAGTGGGCA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 901877401 1:12174789-12174811 AACCTGACTTCGAGGGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 93
901877396_901877400 19 Left 901877396 1:12174740-12174762 CCTCTTTTGGACACTAGTGGGCA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 901877400 1:12174782-12174804 ACAGTGTAACCTGACTTCGAGGG 0: 1
1: 0
2: 0
3: 3
4: 45
901877396_901877399 18 Left 901877396 1:12174740-12174762 CCTCTTTTGGACACTAGTGGGCA 0: 1
1: 0
2: 0
3: 7
4: 87
Right 901877399 1:12174781-12174803 GACAGTGTAACCTGACTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901877396 Original CRISPR TGCCCACTAGTGTCCAAAAG AGG (reversed) Intronic
901290807 1:8122850-8122872 TGCCCTCTACGGTCTAAAAGGGG - Intergenic
901877396 1:12174740-12174762 TGCCCACTAGTGTCCAAAAGAGG - Intronic
904275261 1:29379652-29379674 CGCCATCTAGTGTCAAAAAGAGG - Intergenic
905703745 1:40039418-40039440 TGCCCTCTAGTTTTCAAATGAGG - Intergenic
906343669 1:45002269-45002291 TGCCCACTTGGCTCCAGAAGTGG + Intergenic
906672885 1:47669982-47670004 TGCCAAACAGTGTCCCAAAGTGG + Intergenic
911679692 1:100700804-100700826 TGCCCACTAATCTGCAAATGAGG - Intergenic
915798903 1:158767278-158767300 CTCTCACCAGTGTCCAAAAGAGG - Intergenic
915997162 1:160575162-160575184 TGCCTCCTAGAGTCAAAAAGTGG + Intronic
917808867 1:178638320-178638342 TGCCCAGCAGTGTCCAGAAGAGG - Intergenic
922216206 1:223522303-223522325 TGCCCAGTAGTTACCAAATGGGG + Intergenic
1069641484 10:69958466-69958488 TGCCCTCTAGTGACCACAAAGGG + Intronic
1072036643 10:91568982-91569004 TGCCCACTTGTCACCAATAGAGG + Intergenic
1072284406 10:93899240-93899262 TTCCCTCTAGTTTACAAAAGAGG - Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080428371 11:32176386-32176408 TGCCCTCTAGTGGGCAAAGGTGG + Intergenic
1084353014 11:68617122-68617144 TGCCCACTAGTTTCCTAAACTGG - Intergenic
1084601815 11:70150160-70150182 TGCCCATGGGTCTCCAAAAGTGG + Intronic
1084786199 11:71443140-71443162 TGCCAAATAGTGTCCCACAGTGG + Intronic
1107404340 13:40098640-40098662 GGCCCACTAGTGTCTGGAAGAGG - Intergenic
1107457893 13:40571573-40571595 TGCCCATCAGTGACCTAAAGGGG + Intronic
1109009993 13:56928285-56928307 TCCCCACTACTTTCCAATAGTGG + Intergenic
1110524527 13:76521096-76521118 TACCCACTAGTTTGCAGAAGGGG - Intergenic
1113034385 13:106032786-106032808 AGCCAACTACTGGCCAAAAGAGG - Intergenic
1114586889 14:23823777-23823799 TGCCAATTAATGTCCACAAGAGG + Intergenic
1115425509 14:33254342-33254364 TGCTCAATAGAGTGCAAAAGAGG - Intronic
1119902361 14:78272297-78272319 TGCACTCTAGTGTCAAAAAGTGG - Intronic
1121507237 14:94486435-94486457 TGCCCTCTAGTGGCCACAGGCGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1130133140 15:81160403-81160425 TGCCCTCTTGTGTCCAGGAGGGG + Intronic
1130874150 15:87997791-87997813 TCTCTACAAGTGTCCAAAAGGGG - Intronic
1134904221 16:17965761-17965783 TGCCAACCAGTATACAAAAGGGG - Intergenic
1135463730 16:22667167-22667189 TGCCCAATTGTTTTCAAAAGTGG + Intergenic
1138599676 16:58047090-58047112 TGCCCTCAAGAGTCCAGAAGAGG + Intergenic
1140893604 16:79306063-79306085 TGACCACTAGCTTCCAAAGGAGG + Intergenic
1142218342 16:88840899-88840921 TGGCCACAAGTTTCCAAATGAGG - Intronic
1144418096 17:15070616-15070638 TGTCCCCTTGTGTTCAAAAGAGG - Intergenic
1144658950 17:17056101-17056123 TGGCCCCTAGTGTCCAGGAGCGG + Intronic
1163766486 19:19166094-19166116 TGCCCACTCCTGTGCAAAACAGG - Intronic
1165007146 19:32816676-32816698 TACCCAATAGTGTTCCAAAGTGG + Intronic
925054800 2:849220-849242 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054809 2:849268-849290 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054818 2:849316-849338 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054848 2:849505-849527 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054868 2:849647-849669 TTCCCACGAGTGTTCACAAGTGG + Intergenic
925054889 2:849789-849811 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054909 2:849931-849953 TTCCCACGAGTGTTCACAAGTGG + Intergenic
925054931 2:850073-850095 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054960 2:850262-850284 TTCCCACGAGTGTTCACAAGGGG + Intergenic
925054969 2:850310-850332 TTCCCACGAGTGTTCACAAGGGG + Intergenic
940677839 2:156746637-156746659 TGCCCACCAGTTGCCAACAGGGG - Intergenic
1170160765 20:13307985-13308007 TGCCCAGTAGTTTTCCAAAGTGG + Intergenic
1179374991 21:40842129-40842151 CGCCCACTAGTGTCCTATGGCGG + Intronic
1182139781 22:27943665-27943687 TGCCAAATAGTTTTCAAAAGTGG + Intergenic
1183168627 22:36167078-36167100 GGCCCACAAGTTTTCAAAAGAGG + Intergenic
1184152092 22:42645172-42645194 TCCCCACAAGTCTCCAGAAGTGG + Intronic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
956216106 3:66850668-66850690 TGCCCAGTTGTTTTCAAAAGTGG - Intergenic
959931595 3:111989255-111989277 GGCCCTCTAGTGTCCAAAGAAGG - Intronic
961752084 3:129102728-129102750 TGCCTACTATATTCCAAAAGAGG + Intronic
968838508 4:2982574-2982596 TGCCCTCTAGATTCCACAAGTGG - Intronic
974374711 4:61061492-61061514 TGCCCCCTAGTTTGTAAAAGAGG - Intergenic
975025943 4:69549209-69549231 TTCCAGCCAGTGTCCAAAAGTGG + Intergenic
975526135 4:75352598-75352620 TGCCCAGTGGTGTCCCAGAGAGG + Intergenic
977827883 4:101554904-101554926 TGTCTACTATTGTCCAAATGTGG + Intronic
981205551 4:142035525-142035547 AGCCCACTGGTGTTCAAAAGTGG + Intronic
984404347 4:179307735-179307757 TGCCACCTAGTGGCAAAAAGAGG + Intergenic
984907852 4:184646914-184646936 TGCTCACTGGTATTCAAAAGTGG + Intronic
986339981 5:6780551-6780573 TGCCCTCTAGTAGCCCAAAGGGG - Intergenic
987807661 5:22791221-22791243 TGCCCACTAGTCTTCAAAGCAGG + Intronic
990984301 5:61626791-61626813 TACCCACATGTGGCCAAAAGAGG + Intergenic
996749925 5:126878178-126878200 TACTTACTAGTGTCCAAAAGAGG + Exonic
997432010 5:133847359-133847381 TGCCCATTGGTGCCCCAAAGGGG - Intergenic
998748454 5:145289669-145289691 TGCCAAATAGTGTTCTAAAGTGG + Intergenic
1000258564 5:159564144-159564166 TTCCCACTGGTTTCCAACAGTGG + Intergenic
1003790430 6:9540695-9540717 TGCCCTCTAGAGGGCAAAAGGGG - Intergenic
1005894958 6:30170194-30170216 TGCCCTCTAGAGACCAAAAGGGG + Intronic
1006454999 6:34126597-34126619 TGCCCACTAGTGCCCACTACTGG - Intronic
1007677435 6:43608459-43608481 TGCCACCTAGTGGGCAAAAGCGG - Intronic
1012734782 6:102925226-102925248 CGCCCACCAGTCCCCAAAAGTGG - Intergenic
1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG + Intronic
1027134351 7:75613542-75613564 TGCCCTCTAGGGACCAAAGGCGG - Intronic
1030630213 7:111887616-111887638 TGGGCACTAGTGACCTAAAGGGG + Intronic
1035102224 7:156409914-156409936 TGCCCAATAGTTTTCATAAGCGG + Intergenic
1046311582 8:112444277-112444299 TGCCAAATAGTTTCCCAAAGTGG - Intronic
1046895759 8:119470690-119470712 AAACCACTATTGTCCAAAAGTGG - Intergenic
1047034991 8:120927800-120927822 TTCCCAATAGTGTGGAAAAGAGG + Intergenic
1049953033 9:663907-663929 TGCCTCCTTGTGTCCCAAAGTGG - Intronic
1050583015 9:7080876-7080898 TGACCACTAGTTTATAAAAGAGG + Intergenic
1053420080 9:37971846-37971868 TGCCCACTTCTGCCCAAAGGTGG - Intronic
1056033645 9:82581527-82581549 TACCCACTAGTGCCAAAAAGGGG + Intergenic
1058042831 9:100323128-100323150 TGCCATCCAGTGGCCAAAAGGGG + Intronic
1060954422 9:127628365-127628387 TGCCACCTAGTATCCAAAAAGGG + Intronic
1061694616 9:132363037-132363059 TGCCCTCTGGCATCCAAAAGAGG + Intergenic
1062441774 9:136572939-136572961 TGCCCACTGGTGTCCAGAGCTGG - Intergenic