ID: 901878321

View in Genome Browser
Species Human (GRCh38)
Location 1:12179611-12179633
Sequence CTGTGAACACACTGTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901878321_901878331 27 Left 901878321 1:12179611-12179633 CCCTGCTCACAGTGTGTTCACAG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 901878331 1:12179661-12179683 TGTCTGTAAAATGAGGGAGCAGG 0: 1
1: 0
2: 12
3: 105
4: 534
901878321_901878329 21 Left 901878321 1:12179611-12179633 CCCTGCTCACAGTGTGTTCACAG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 901878329 1:12179655-12179677 GCTCCTTGTCTGTAAAATGAGGG 0: 1
1: 2
2: 27
3: 145
4: 856
901878321_901878328 20 Left 901878321 1:12179611-12179633 CCCTGCTCACAGTGTGTTCACAG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 901878328 1:12179654-12179676 GGCTCCTTGTCTGTAAAATGAGG 0: 1
1: 7
2: 124
3: 807
4: 3019
901878321_901878324 -1 Left 901878321 1:12179611-12179633 CCCTGCTCACAGTGTGTTCACAG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 901878324 1:12179633-12179655 GAAGAGTCACTCCCCTCTGTGGG 0: 1
1: 1
2: 1
3: 11
4: 148
901878321_901878323 -2 Left 901878321 1:12179611-12179633 CCCTGCTCACAGTGTGTTCACAG 0: 1
1: 0
2: 2
3: 22
4: 291
Right 901878323 1:12179632-12179654 AGAAGAGTCACTCCCCTCTGTGG 0: 1
1: 1
2: 0
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901878321 Original CRISPR CTGTGAACACACTGTGAGCA GGG (reversed) Intronic
901220324 1:7580119-7580141 CTGTGAGCCCGCTGTGGGCAGGG - Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
902712212 1:18248229-18248251 CTGTGTACACAGTGGGAGCCTGG + Intronic
903791195 1:25894235-25894257 CAGTCTGCACACTGTGAGCAGGG + Intronic
903827956 1:26158809-26158831 CTGTGGAAGCACTGTGAGCTTGG - Intergenic
904168944 1:28577596-28577618 CTCTGAAGACACTGTGTCCAGGG - Exonic
906389179 1:45399089-45399111 CTGAGAACTAACTGTGAACAAGG - Intronic
906748226 1:48236337-48236359 CTGTGAGCACGCTGAGGGCAGGG - Intronic
907119736 1:51998009-51998031 CAGGGCACACACTGTCAGCAGGG + Intergenic
907668014 1:56450237-56450259 CTTTGCACAAACTGTGGGCAGGG + Intergenic
908409451 1:63848099-63848121 CTGTGAACACTCTGGGAAAATGG + Intronic
908980788 1:69955216-69955238 CTATGAACTCACTGAGGGCAAGG - Intronic
909556463 1:76959841-76959863 CTGAGAACCCACTTTGGGCAAGG - Intronic
909755944 1:79225626-79225648 CTGTGAACACAATGTTAAAATGG + Intergenic
910472242 1:87567107-87567129 CTGGGAACAATCTGTAAGCATGG + Intergenic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
912788232 1:112624983-112625005 CTGTGCATACACTGTGTGCTTGG - Intronic
913319148 1:117576453-117576475 CTGCGACCACACTGTGCCCATGG - Intergenic
913355152 1:117913091-117913113 CTGTCAAGACACTCTGGGCAGGG + Intronic
914449706 1:147780174-147780196 CTGAGAACATACTCTGTGCAAGG + Intergenic
915476444 1:156155452-156155474 CTGTGAACACCTTGAGGGCAGGG - Intronic
915730254 1:158048524-158048546 CTGTGAGTTCACTGTGGGCAAGG - Intronic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
919101401 1:193101579-193101601 CTATGAACACACTGTGAAGCAGG + Intronic
919798684 1:201337441-201337463 CTGTGAACTCCCTGAGGGCAGGG + Intergenic
920986834 1:210898586-210898608 CTGAGCACCCACTGTGAGCCAGG + Intronic
922349291 1:224722565-224722587 CAGGGACCACACTTTGAGCAGGG + Intronic
924794352 1:247281933-247281955 CTGTCCACAAACTGTGAGGAAGG + Intergenic
1062815208 10:494311-494333 GTGTGAACACACAGTGACCATGG - Intronic
1063056795 10:2513605-2513627 ATATACACACACTGTGAGCAGGG + Intergenic
1063318875 10:5033705-5033727 CTATGAAAACACTATGAGCAAGG + Intronic
1063933101 10:11049471-11049493 CTGTGAAAACAATGTGAACCGGG + Intronic
1065218157 10:23470727-23470749 CTGAACACACACTGTGTGCAGGG - Intergenic
1065727762 10:28682626-28682648 CTTTGTACACACTGTCACCAGGG + Exonic
1067509996 10:46886593-46886615 CTGTGACCTCACAGTGAGAATGG - Intergenic
1067652257 10:48165265-48165287 CTGTGACCTCACAGTGAGAATGG + Intronic
1069074305 10:64021765-64021787 CAGTGACCACACTGTGACTATGG - Intergenic
1069321529 10:67177628-67177650 CTTTGAGCAAACGGTGAGCAAGG + Intronic
1072434071 10:95399497-95399519 CTCTGATCACACTGTTGGCAAGG - Intronic
1073077726 10:100835177-100835199 CAGAGATCAGACTGTGAGCATGG - Intergenic
1075377321 10:121989112-121989134 CAGTAAACACACTGTGAGTGCGG + Intergenic
1076215443 10:128689581-128689603 CTGTGAACCCCCTGAGGGCAGGG - Intergenic
1076997497 11:305623-305645 CTGTGGACAAACTGTGAGGGAGG - Intergenic
1077552036 11:3204696-3204718 CTGAGAACACTGTGTGAGCAAGG + Intergenic
1078628003 11:12975974-12975996 CTGTGTACTCTCTGTGGGCAGGG - Intergenic
1083291104 11:61690712-61690734 ATGTGCACACCCTGAGAGCAGGG - Intronic
1084209403 11:67614143-67614165 CTGAGAACCGCCTGTGAGCAAGG - Intergenic
1084624725 11:70297483-70297505 CTGTGGACACACTGAGTACAAGG - Intronic
1084643241 11:70438337-70438359 CTGTGCACATACTGTGTGCTGGG + Intergenic
1086091076 11:83005340-83005362 ATTTGAACACACTGTGTGCTAGG + Intronic
1086808806 11:91279091-91279113 CTGAGAACAAACTTTGAGTAAGG - Intergenic
1088744713 11:112795874-112795896 TTGTGGTCACACTGTGACCATGG + Intergenic
1088893534 11:114061606-114061628 CAGTGAATGCACTGAGAGCAAGG - Intronic
1089010660 11:115129231-115129253 CTATGAAAACACTGTGAGATCGG + Intergenic
1089255440 11:117191603-117191625 CTGTGAGCACCCTGAGATCAGGG - Intronic
1089582138 11:119488150-119488172 CTGACAACACAGTGTGAACAGGG + Intergenic
1090776820 11:129972640-129972662 CTGTGGCCACACTGTGACCTGGG - Intronic
1091081089 11:132668988-132669010 GTGTCAACACACTGTGAAAAAGG - Intronic
1092250407 12:6891914-6891936 CTGTGAATACTCTGGGAGGATGG + Intronic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1093912254 12:24761532-24761554 TTTTTAACACACTGTGAGAAGGG - Intergenic
1094106796 12:26821283-26821305 CGGGGAAATCACTGTGAGCAGGG - Intronic
1095542307 12:43324721-43324743 ATGTGAACTCACAGTGAGAATGG - Intergenic
1098031251 12:66256990-66257012 TTATGAACACAATGAGAGCAGGG - Intergenic
1098362666 12:69670237-69670259 CTGAGAATACACTGAGGGCAGGG + Intronic
1099551530 12:84050877-84050899 CTGTGGAAACACTGTAAGCTTGG + Intergenic
1100865956 12:98857061-98857083 CTAAGAACTCACTGTGTGCAGGG - Intronic
1101552435 12:105775269-105775291 CTGATAACAGAATGTGAGCAAGG - Intergenic
1102381138 12:112467836-112467858 GTGAGAACTCACTGTGAGGATGG + Intronic
1103141529 12:118552986-118553008 CTGTGAACGCATTGTGTGCTTGG + Intergenic
1104024906 12:125018607-125018629 CTGTGAACAGCGTGTCAGCAGGG - Intronic
1104984297 12:132587871-132587893 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1104984319 12:132587960-132587982 CTGGGAGCACTCTGTGAGGAGGG + Intergenic
1105683145 13:22750943-22750965 GTGTTAAAATACTGTGAGCACGG + Intergenic
1105872417 13:24517177-24517199 CTGTGCAGACAGTGTGGGCACGG - Intergenic
1108920830 13:55672273-55672295 CAGTAAACACACTGTGCACATGG + Intergenic
1109371960 13:61434243-61434265 GTGTGTACAGACTGTGAGTATGG - Intergenic
1110777012 13:79419331-79419353 GTGTGAACAAACTGTGAGAGAGG - Intergenic
1112238707 13:97659776-97659798 CTTTGCACACACTGTGTGCCTGG - Intergenic
1112415806 13:99202401-99202423 CTGGGATCACACAGTGAGCCAGG + Intronic
1112566342 13:100553897-100553919 CTGTGGACACACTGTGTACCTGG - Intronic
1112858359 13:103798630-103798652 CTTTGAACATACTGTCAGCCTGG + Intergenic
1113395808 13:109946497-109946519 CTCAGAACACACTGTGATCATGG + Intergenic
1114920055 14:27314737-27314759 CTGTGAATACATAGTGAGCATGG + Intergenic
1115922387 14:38390634-38390656 CTGTGACAACACTGAAAGCAGGG - Intergenic
1118206782 14:63729854-63729876 CTGTGAACAACTTGAGAGCATGG - Intergenic
1118385651 14:65253595-65253617 CTGTGAACTCACAGTGAGCAAGG + Intergenic
1118685998 14:68291861-68291883 CTGTGAACAGACAGGGAGAAGGG - Intronic
1118841725 14:69518367-69518389 CTGTGAGCTCCCTGAGAGCAAGG + Intronic
1120936626 14:89902405-89902427 CTGTGAACTCCCTGACAGCAGGG + Intronic
1121093832 14:91202158-91202180 CTGTGAAAACCCTGTGAGGCAGG + Intronic
1121720058 14:96103034-96103056 GTGAGCACACACTGTGAGTAAGG - Intergenic
1121988447 14:98530633-98530655 CTGTCTACTCACTGTGAGCTGGG - Intergenic
1122239858 14:100355968-100355990 CTGAGAACTCACTGTGTGCTCGG + Intronic
1122244552 14:100393211-100393233 GTGTAAATACACTGTGAGTAGGG - Intronic
1122400081 14:101461824-101461846 CCGTGAACACACTGCGTTCAGGG + Intergenic
1122674903 14:103404423-103404445 CTGTGTACACACTGTGTACATGG - Intronic
1122975726 14:105169964-105169986 CTGTGAACACCCCATGCGCAGGG + Intergenic
1122997575 14:105273683-105273705 CTGTGAACACTTTGTTAACAAGG - Intronic
1123052823 14:105555027-105555049 CTGTGAACACTTTGTTAACAAGG - Intergenic
1123077404 14:105675415-105675437 CTGTGAACACTTTGTTAACAAGG - Intergenic
1124840223 15:33234620-33234642 TTGTGAACATACTGTGTGAAGGG + Intergenic
1126499755 15:49332404-49332426 CTGTAAGCTCATTGTGAGCAGGG + Intronic
1126526721 15:49664328-49664350 CTGTGAACTCCCTGTGGGCTGGG + Intergenic
1127038955 15:54952102-54952124 TTGTTAACACACTGTGTGGAAGG - Intergenic
1127809955 15:62557116-62557138 CTAGGAACACACTTTGAGCAAGG + Intronic
1131464127 15:92641212-92641234 CTGAAAACACACTGTTGGCAAGG + Intronic
1133653979 16:7841724-7841746 CTGTGAACACACTGTGCCCAGGG + Intergenic
1135284454 16:21181496-21181518 CTGTGATCACAGTGTCATCAGGG + Intergenic
1135682732 16:24472166-24472188 CTGTGAACACTCTCCTAGCAAGG + Intergenic
1136449133 16:30342829-30342851 CTGTGACCACTCTGTGACAAGGG + Intergenic
1139117316 16:63972148-63972170 CTTTGAACAGACAGAGAGCATGG - Intergenic
1140331729 16:74064142-74064164 CTGTGAACTCTCTAAGAGCAGGG - Intergenic
1140656649 16:77148015-77148037 CTGTGGACACAATGAGAACAAGG + Intergenic
1140704098 16:77610020-77610042 CTGGGAACACCCTGAGGGCAAGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142477855 17:200295-200317 CTCTGAGAACACTGTGATCATGG - Intergenic
1143537453 17:7549634-7549656 GTGTGAACACAGTGCGTGCATGG + Intronic
1143866854 17:9929890-9929912 CTGTGAGGACACTTTGAGGAAGG - Intronic
1144575840 17:16428828-16428850 CTGGGACACCACTGTGAGCAGGG - Exonic
1144968799 17:19094175-19094197 CTGAGCACACACTGTGAGTCAGG + Exonic
1144979117 17:19157891-19157913 CTGAGCACACACTGTGAGTCAGG - Exonic
1144989105 17:19220341-19220363 CTGAGCACACACTGTGAGTCAGG + Exonic
1145861229 17:28212020-28212042 CTTTGTTTACACTGTGAGCATGG - Intergenic
1147158980 17:38559799-38559821 AAGTGAACAAACTGTGAGCCTGG + Intronic
1149353710 17:55817871-55817893 CTAAGAACACACTATGAGCCAGG + Intronic
1149978080 17:61286612-61286634 CTGTGGGCACGCTGTTAGCAGGG + Intronic
1151393687 17:73804841-73804863 CACTGAACACACTTAGAGCATGG - Intergenic
1152470040 17:80486027-80486049 GTGTGTGCTCACTGTGAGCAGGG - Intergenic
1153548232 18:6232647-6232669 CTGTGAACCTTGTGTGAGCAAGG - Intronic
1155572069 18:27205807-27205829 ATGTGAAGACACAGTGAGAAGGG - Intergenic
1156371053 18:36471434-36471456 CTGTGGACACAGGGTGACCAAGG - Intronic
1156468035 18:37360385-37360407 CTGAGCACAACCTGTGAGCAAGG + Intronic
1156497780 18:37537336-37537358 CTGTGTACACGCTGAGAGCCTGG + Intronic
1156567139 18:38204650-38204672 ATGTGTACACCCTGTGGGCAGGG + Intergenic
1157087657 18:44598025-44598047 ATGTGAACACAGTCTGAGCCTGG - Intergenic
1158433524 18:57415619-57415641 GTTTGCACACAGTGTGAGCAGGG - Intergenic
1159019869 18:63134511-63134533 CTGAGAACACACACTGAGCTCGG - Intronic
1160227123 18:77020006-77020028 CTGTGAACAGACTGTGGAAAGGG + Intronic
1160687771 19:444832-444854 CTGTGGACACACTGTGCACGTGG + Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1161777692 19:6272620-6272642 CTGTGAACTCTCTGAGAGCAGGG + Intronic
1162624593 19:11874511-11874533 CTGTGTCCACACTGTGGGGAGGG + Intronic
1162629687 19:11917345-11917367 CTGTGTCCACACTGTGGGGAGGG + Intergenic
1162634741 19:11958576-11958598 CTGTGTCCACACTGTGGGGAGGG + Intronic
1163557128 19:17999200-17999222 CTGGGACCACACTGCGAGGAAGG + Exonic
1164979601 19:32603900-32603922 CTGTGTTCACACTGTGAGGATGG + Intronic
1165338971 19:35196943-35196965 ATGTGAAGACACAGTGAGAAGGG - Intergenic
1165374594 19:35432814-35432836 CTCTGAACACACAGTGGTCAGGG - Intergenic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1166628763 19:44386524-44386546 CAGTACACACACTGTGAGCGTGG - Exonic
1166975958 19:46605162-46605184 CTGTGCCCTCACTGTGCGCAGGG + Intronic
1167592153 19:50409848-50409870 CTGAGCACACACTGTGGTCAGGG + Intronic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
929057316 2:37889490-37889512 CTGTGAACCCACAGAGACCATGG + Intergenic
930770010 2:55121221-55121243 CTGTGAGCTCCCTGAGAGCAGGG - Intergenic
930805265 2:55483973-55483995 CTGTGAACACACTGCCAGACAGG - Intergenic
931517515 2:63058796-63058818 CTGAGAACACACTGTGAAGCGGG + Intergenic
932494963 2:72141647-72141669 CGGTGAACTCACTGTGGCCAAGG - Intronic
932569215 2:72929143-72929165 ATGTGGACACACCGTGAGCTAGG - Intronic
934127433 2:88910952-88910974 CTGTGAAGATGCTGTGAGCAAGG + Intergenic
934660718 2:96142394-96142416 CTGTGATCTGCCTGTGAGCAGGG - Intergenic
935432458 2:102990797-102990819 CTCAGAATAGACTGTGAGCAGGG + Intergenic
935899590 2:107776590-107776612 CTGCGCACACACTGAGAACAGGG + Intergenic
938544856 2:132318662-132318684 CAGTACACACATTGTGAGCATGG + Intergenic
940186057 2:150985907-150985929 CTGTGAAAGCACTGTTAGCCTGG - Intergenic
941440842 2:165533505-165533527 CAGGGCACACAATGTGAGCATGG - Intronic
943265785 2:185730272-185730294 CTGTGAACAAACTGTTGGCCAGG + Intergenic
944139056 2:196434967-196434989 CTGTGAACTCAATGGGAGGATGG - Intronic
945186231 2:207142702-207142724 AAGTGCACACAGTGTGAGCAAGG + Intronic
946202379 2:218078043-218078065 CTGTGCACCCACTCTGAGCCAGG + Intronic
946237831 2:218335549-218335571 CACTGAACACACACTGAGCAAGG - Intronic
946582980 2:221150730-221150752 ATGTGAGCACACTGTGAGAAAGG - Intergenic
946682147 2:222228603-222228625 CTCTGAACTCAATGTGAGTAAGG - Intronic
948649578 2:239432451-239432473 ATGTGAAGACACAGTGAGCCAGG - Intergenic
1168910501 20:1443181-1443203 TTCTGAAGACACTGTGTGCATGG + Exonic
1169571574 20:6912324-6912346 CTGTAAATACACTGGGTGCAGGG - Intergenic
1171126298 20:22604840-22604862 CTGTGATCAAAGTGTGAGCAGGG - Intergenic
1171873714 20:30551396-30551418 CAGTACACACATTGTGAGCATGG + Intergenic
1172866356 20:38101958-38101980 CTGAGAACAGAGTGTTAGCATGG - Intronic
1172979520 20:38930389-38930411 CTGAGATCACACAGTTAGCATGG + Intronic
1174294546 20:49536187-49536209 CTGTGAAGCCAATGTTAGCATGG - Intronic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1178875849 21:36413276-36413298 CTCTGAACACACTGCAAGCCTGG + Exonic
1179019894 21:37629649-37629671 CTGAGAACAAAATGTGAACAGGG - Intronic
1179219191 21:39391324-39391346 CTGTGCACACACTGTGACCGGGG - Intronic
1180076774 21:45467147-45467169 CTGGGAAGTCACTCTGAGCAGGG + Intronic
1181535124 22:23537942-23537964 CTGTAAACACATTGTTAACAAGG - Intergenic
1184430637 22:44439958-44439980 ATGTGAACCCCCTGGGAGCAAGG + Intergenic
1184607684 22:45583503-45583525 CTGTGCACCCACTGTGTGCCAGG - Intronic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
949894901 3:8761705-8761727 CTGAGTGCCCACTGTGAGCAAGG - Intronic
950019875 3:9779763-9779785 CTGTGAATCCACTTTGAGCTGGG + Intronic
950127961 3:10522132-10522154 CTGTGTACCTACTGTGAGCCAGG + Intronic
953604806 3:44404911-44404933 CTGTGAGGACCCTGTGAGCATGG - Intronic
954149887 3:48652049-48652071 CTGTGGACACACAGCCAGCAAGG + Intronic
954841854 3:53518283-53518305 ATGTGAACTCCTTGTGAGCAGGG + Intronic
956128722 3:66035745-66035767 CTGTGAACAATCTGTGCACAAGG + Intronic
956304059 3:67804930-67804952 CTGTGACCCCACTGGCAGCATGG - Intergenic
957970638 3:87377342-87377364 CTGTGAACTCAATGTGAACGAGG + Intergenic
958866473 3:99507065-99507087 CTGTCAACACCCTGAGAACATGG + Intergenic
959082731 3:101819106-101819128 CCGTGAACTCACTGAGGGCAAGG + Intronic
959407774 3:105981472-105981494 CTGTAAACACACTTCTAGCAAGG - Intergenic
959877050 3:111395387-111395409 ATGTGAAGACACAGTGAGAAGGG + Intronic
961057719 3:123803361-123803383 CTGTGCACCTACTTTGAGCAAGG - Intronic
961865662 3:129951856-129951878 CTGTGACACCACTGTAAGCATGG - Intergenic
964753982 3:160078121-160078143 CTGTGAAGACTCTGTGAACGAGG - Intergenic
965085738 3:164095150-164095172 CTGTGTACTTACTGTGTGCAAGG + Intergenic
968000208 3:195200397-195200419 CAGTGAACCCACTGTGTGCTTGG - Intronic
968264426 3:197351699-197351721 CTGAAGACACACTGTGAACAAGG + Intergenic
969347006 4:6576013-6576035 CTGTGGGCACCCTGTGTGCAGGG + Intronic
970909909 4:21262865-21262887 CTGTGAACAAACTGAGGACATGG + Intronic
971094346 4:23382832-23382854 CAGTGAAAACCCTGTGAGCTTGG - Intergenic
971166372 4:24188165-24188187 CAGCTAAGACACTGTGAGCAGGG + Intergenic
972015424 4:34237178-34237200 CTGTGAACAAACTGAAATCAAGG + Intergenic
972102624 4:35441900-35441922 CAGTGAACATCATGTGAGCATGG + Intergenic
973933443 4:55817315-55817337 CTATGAAAACAATTTGAGCAAGG - Intergenic
975384425 4:73739200-73739222 CTGTGAACACACTGTGGAGGGGG - Intergenic
977603768 4:98961483-98961505 ATGTGAAGACACAGTGATCAAGG + Intergenic
977628069 4:99210186-99210208 CTGTGAATACACAGTGATAAAGG - Exonic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978571648 4:110144383-110144405 ATGTGAATATACTGTAAGCATGG - Intronic
984679325 4:182589607-182589629 TTGTGAACTCACTGAAAGCAAGG + Intronic
984816278 4:183839993-183840015 CTGTGAACACTCAGCGTGCAAGG + Intergenic
985618278 5:937664-937686 CTGAGCACACACTATAAGCATGG + Intergenic
986479567 5:8172688-8172710 CTGTGGACAGACTGTGATAATGG + Intergenic
987439629 5:17940387-17940409 CTGTGAACAGAGTGAGAGAAGGG - Intergenic
988877526 5:35463939-35463961 CAGTGTATATACTGTGAGCAGGG - Intergenic
992980288 5:82163352-82163374 CAGTGAACTGACTGTGAGTAGGG + Intronic
993508420 5:88740525-88740547 CTGAGATCACCCTGTCAGCAAGG + Intronic
996354244 5:122578909-122578931 CTGCAAAATCACTGTGAGCAAGG + Intergenic
998554653 5:143111528-143111550 CTGAGAACTTACTGTGAGCCAGG - Intronic
999297991 5:150472582-150472604 GTGGGAACCCACTGAGAGCATGG - Intergenic
999931835 5:156441921-156441943 CTGTGCACTCACTGTCATCAGGG + Intronic
1000424765 5:161077634-161077656 ATGTGAAGACACAGTGAGAAAGG - Intergenic
1001053740 5:168432743-168432765 ATGTAAACAAACTGTGAGGAGGG + Intronic
1001316133 5:170642360-170642382 CTGTGCACACAGTGCCAGCAAGG + Intronic
1001616810 5:173049348-173049370 CTGTGAACACCATGGGAGAAGGG - Intergenic
1003087564 6:3072954-3072976 CTGGGATCACTCTGTCAGCAGGG - Intronic
1003294330 6:4810741-4810763 ATGTGAGGACACTGTGAGAAGGG - Intronic
1004413398 6:15402419-15402441 CTGTGAACATGCTGTGTTCATGG + Intronic
1004865669 6:19851604-19851626 CTGTGCACACTTTGTGAGGAGGG + Intergenic
1006741885 6:36314700-36314722 CTGTGAGCATCCTGTGGGCAGGG + Intergenic
1006919311 6:37617001-37617023 CTGTGGAGACCCTGTAAGCAGGG - Intergenic
1007692168 6:43709606-43709628 CTCTAAACACTCTGTGAGCTGGG + Intergenic
1007766658 6:44164664-44164686 CGGTGGACCCAGTGTGAGCATGG + Intronic
1009524226 6:64723109-64723131 TTAAGAACACACAGTGAGCATGG + Intronic
1009569229 6:65360735-65360757 CTGTGAGCTCAGTGAGAGCAAGG - Intronic
1011117529 6:83910156-83910178 CTGTCACAGCACTGTGAGCAAGG + Intronic
1012193032 6:96303989-96304011 CTGTGAAAACACTGAAAGGAAGG + Intergenic
1013582467 6:111549996-111550018 CTGACACCACAGTGTGAGCATGG - Intergenic
1015874463 6:137808918-137808940 CTGTGAGCACAGTGTAAGCCAGG + Intergenic
1017064915 6:150519664-150519686 TACTGACCACACTGTGAGCAAGG + Intergenic
1017836503 6:158183560-158183582 CTTTGTTTACACTGTGAGCATGG + Intronic
1021654384 7:22860727-22860749 CTGTTCACAGAATGTGAGCATGG - Intergenic
1021958578 7:25851470-25851492 CTGAGAACCCACTGTATGCATGG + Intergenic
1023049540 7:36239201-36239223 GTGTGAACACAATGTCAGCAAGG - Intronic
1025935502 7:66032567-66032589 TGGTGAACACCCTGGGAGCATGG - Intergenic
1025948832 7:66127308-66127330 TGGTGAACACCCTGGGAGCATGG + Intronic
1027431273 7:78114905-78114927 CTGTGGACACACTGTGAGAGGGG + Intronic
1027562669 7:79751592-79751614 CTGTAAACATATTGTTAGCAAGG + Intergenic
1028399550 7:90409829-90409851 CTATAAACACATTGGGAGCAAGG + Intronic
1028509514 7:91608555-91608577 CTGTGAAACCACTGGGGGCATGG + Intergenic
1028966367 7:96806055-96806077 CTCTGAATACAGTGTGAGAAGGG - Intergenic
1030627063 7:111855782-111855804 CTGTAAACAGACAGAGAGCAGGG + Intronic
1032534141 7:132646556-132646578 CTGTGAGGACACAGTGAGGATGG + Intronic
1033497961 7:141918513-141918535 AAGTGAACACATTGTGATCATGG + Intronic
1033773765 7:144583168-144583190 ATGAGAAAACACTGGGAGCAAGG - Intronic
1034701311 7:153098712-153098734 CTGAAAACACACTGTCAGCAGGG + Intergenic
1035396706 7:158539718-158539740 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396719 7:158539795-158539817 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396735 7:158539907-158539929 CTGGGGACATACTGTGAGCCTGG + Intronic
1035396749 7:158539984-158540006 CTGGGGACATACTGTGAGCCTGG + Intronic
1035778865 8:2211375-2211397 CTGTGAACACCCAGCAAGCAAGG - Intergenic
1036149428 8:6283917-6283939 CTGAGACCACACTGTGACCCAGG + Intergenic
1037102757 8:15067256-15067278 CTGTGAGTACAGTGTGTGCAGGG - Intronic
1037408102 8:18565255-18565277 TTGTGAGCAGACTGTGAACAGGG + Intronic
1037743685 8:21627035-21627057 CTGTGAATACACTGGCTGCATGG - Intergenic
1037926239 8:22846138-22846160 CTGTGCACACAGTGTATGCAGGG - Intronic
1041541510 8:58990204-58990226 CTGTGATCACACAGATAGCAAGG + Intronic
1042042252 8:64605012-64605034 CTGTGCACAGGATGTGAGCAGGG + Intronic
1042202058 8:66288620-66288642 ATGTGAGCTCTCTGTGAGCAAGG + Intergenic
1043097791 8:75997506-75997528 CTATGAACCCACTGGGAGGAAGG + Intergenic
1046293399 8:112191938-112191960 CTGGCAGCATACTGTGAGCAAGG + Intergenic
1047653762 8:126952964-126952986 CTGTGAAGACGCCTTGAGCAGGG - Intergenic
1047741666 8:127811537-127811559 ATGTTAACACCCTGTGAGCAGGG - Intergenic
1049588158 8:143441348-143441370 CTGGGCACAGACTGAGAGCAGGG + Intronic
1050697608 9:8296866-8296888 CTGCGCATACACTCTGAGCAGGG - Intergenic
1051614851 9:18997429-18997451 CTTTGTTTACACTGTGAGCATGG - Intronic
1053651380 9:40173392-40173414 CTTGGAACACAATGTTAGCAGGG + Intergenic
1054533200 9:66202811-66202833 CTTGGAACACAATGTTAGCAGGG - Intergenic
1055421285 9:76145672-76145694 CTGTGACCACACTGAGACCATGG + Intronic
1056295807 9:85192018-85192040 CTGGGAATACAGTGTGAACAAGG + Intergenic
1056552664 9:87664315-87664337 CTGTGGGCACACTATGCGCAGGG - Intronic
1058368519 9:104236522-104236544 CTGTGAACACTGAGTTAGCAGGG - Intergenic
1059677166 9:116550539-116550561 CTCTGAAAACAGTGTGGGCAAGG + Intronic
1060309763 9:122448699-122448721 CTGTAAACATACTGTTAACAAGG + Intergenic
1060779882 9:126403692-126403714 CTGAGCACTTACTGTGAGCATGG - Intronic
1061241979 9:129379791-129379813 CTGTGCACACTCTGTGTGCAAGG + Intergenic
1061823417 9:133241206-133241228 CAGTGACCACCCAGTGAGCAGGG + Intergenic
1062436626 9:136549265-136549287 CGGTGAACAGACTGTGAGTGTGG - Intergenic
1062613869 9:137387322-137387344 CTGTGAGCACCATGTGTGCACGG - Intronic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1186210499 X:7245458-7245480 CTGTAGACACCATGTGAGCAGGG - Intronic
1188029434 X:25247913-25247935 CAGTGAACTCACTGTGACAAGGG + Intergenic
1192586981 X:72326860-72326882 ATGTGAACACGCTGTGGGTAAGG - Intergenic
1196140242 X:112253567-112253589 CTGTGAACACTTTGAGAGAAAGG - Intergenic
1196159030 X:112462265-112462287 CTTTGTTTACACTGTGAGCATGG - Intergenic
1198542729 X:137657181-137657203 CTGTGAAAACACTGAGGGTATGG + Intergenic
1199514861 X:148664630-148664652 CTGTGAGCTCACTAAGAGCAAGG + Intronic
1200301908 X:154984877-154984899 GTGTGAGCACACTGGGAGCAGGG - Intronic
1200908326 Y:8508676-8508698 CTGTGAAGAAACTGTGAGTCGGG - Intergenic
1201583862 Y:15538992-15539014 CTGTAGACACCATGTGAGCAGGG - Intergenic