ID: 901879781

View in Genome Browser
Species Human (GRCh38)
Location 1:12186985-12187007
Sequence ACTCAGGGGCTTGCTCCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901879768_901879781 8 Left 901879768 1:12186954-12186976 CCAACCCCAGTCTTTCAGGAGAG 0: 1
1: 0
2: 1
3: 16
4: 192
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879766_901879781 16 Left 901879766 1:12186946-12186968 CCGGACTGCCAACCCCAGTCTTT 0: 1
1: 0
2: 0
3: 12
4: 242
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879765_901879781 17 Left 901879765 1:12186945-12186967 CCCGGACTGCCAACCCCAGTCTT 0: 1
1: 0
2: 2
3: 18
4: 187
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879773_901879781 2 Left 901879773 1:12186960-12186982 CCAGTCTTTCAGGAGAGAGGGCA 0: 1
1: 0
2: 1
3: 15
4: 204
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879764_901879781 25 Left 901879764 1:12186937-12186959 CCTGAAAGCCCGGACTGCCAACC 0: 1
1: 0
2: 0
3: 0
4: 86
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879772_901879781 3 Left 901879772 1:12186959-12186981 CCCAGTCTTTCAGGAGAGAGGGC 0: 1
1: 0
2: 1
3: 7
4: 161
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879763_901879781 26 Left 901879763 1:12186936-12186958 CCCTGAAAGCCCGGACTGCCAAC 0: 1
1: 1
2: 0
3: 4
4: 75
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
901879770_901879781 4 Left 901879770 1:12186958-12186980 CCCCAGTCTTTCAGGAGAGAGGG 0: 1
1: 1
2: 3
3: 24
4: 234
Right 901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901879781 Original CRISPR ACTCAGGGGCTTGCTCCCGG GGG Intronic
900108729 1:996909-996931 AGGCAGAGGCTGGCTCCCGGAGG + Intergenic
900114791 1:1023903-1023925 ACTCAGGGACGAGCTCCAGGTGG + Intronic
900882366 1:5391294-5391316 TATCAGGGGCTTGTTCCCTGTGG - Intergenic
901879781 1:12186985-12187007 ACTCAGGGGCTTGCTCCCGGGGG + Intronic
903324505 1:22562459-22562481 AATCAGGCACTTGCTCCCGTGGG + Intergenic
912162413 1:107001699-107001721 ACACATGGGCTTGCTCACAGTGG - Intergenic
917491971 1:175505441-175505463 ACGCAGGGGCTTTTTCCAGGAGG + Intronic
918078056 1:181185419-181185441 ACTCAGGGGCTGCTTCCAGGAGG + Intergenic
920048908 1:203151540-203151562 AATCAGGGGTGTGCTCCTGGTGG + Intronic
922094789 1:222434086-222434108 GGTCAGGGGCTTGTTCCCAGGGG - Intergenic
924933679 1:248750473-248750495 CCTCTGGGGCTTGCACCGGGAGG - Intronic
1063015418 10:2071698-2071720 ATTTAAGGGATTGCTCCCGGGGG - Intergenic
1063577891 10:7278459-7278481 CCTCAGGGCTTTGCTCCCCGGGG - Intronic
1064430696 10:15267696-15267718 ACTCAGGTGCTGGGTCCTGGAGG + Intronic
1067099591 10:43324916-43324938 ACTCAGGGGGCTGCTCCCACTGG - Intergenic
1069532469 10:69229493-69229515 ACTCAGCTGCTTCCTCCCAGGGG - Intronic
1079081173 11:17414651-17414673 TCTCAGGGGCTTGTTCTCAGAGG + Intronic
1081619906 11:44613287-44613309 AGGCAGGGGCTGGCTCTCGGAGG + Intronic
1083333962 11:61912239-61912261 ACCCAGGGCCTGGCTCCCCGGGG + Intronic
1084981834 11:72833141-72833163 ACTGAGGGGCTTGCATCTGGTGG - Intronic
1090653252 11:128824692-128824714 ACTCAGGGGGCAGCTCCGGGTGG + Intergenic
1093554775 12:20458667-20458689 ACTGAGGGGCTTTCTCTGGGGGG - Intronic
1099996535 12:89785358-89785380 ACTGAGGGCCTTGCTCCTGAAGG - Intergenic
1104000222 12:124855411-124855433 GCCCAGGGGCTGGCTCCCTGTGG - Intronic
1104769320 12:131351143-131351165 ACTCAGGGGCTCACTCTCAGGGG + Intergenic
1105356798 13:19666034-19666056 GCTGAGGGGCTGGCTCACGGGGG + Intronic
1106318661 13:28618177-28618199 CCTCAGGGGTTTGCTGCAGGGGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113765199 13:112876827-112876849 ACCCGGGGGCTGGCTCCCAGCGG + Intronic
1115396067 14:32909710-32909732 CCCCAGGGGCATGCTCCCAGGGG + Intergenic
1118573476 14:67218427-67218449 ACTCAGGGACGTGCTCACTGGGG + Intronic
1124079182 15:26475449-26475471 GGGCAGGAGCTTGCTCCCGGGGG + Intergenic
1124964161 15:34420964-34420986 AATCAGGCGGTTGCCCCCGGCGG - Intronic
1124980774 15:34567192-34567214 AATCAGGCGGTTGCCCCCGGCGG - Intronic
1128074524 15:64818000-64818022 ACTGAGGAGCTGGCCCCCGGTGG + Exonic
1128113776 15:65093120-65093142 CCTCCAGGGCTTGCTCTCGGCGG + Exonic
1134810507 16:17163237-17163259 ACTTAGGGACTGGCTCCCAGAGG + Intronic
1136547402 16:30963496-30963518 ACTCAGGGCCTTGCCCCCAGTGG - Exonic
1138650029 16:58454842-58454864 ACTGAGGGGCTTGTTCACCGTGG - Intergenic
1141505959 16:84478858-84478880 ACTCAGGTGCTGGTTCCCAGAGG + Exonic
1143518151 17:7430194-7430216 ACTCAGGGGCATGGGCCTGGGGG - Intergenic
1143950860 17:10631266-10631288 TCTCCGAGGCTTTCTCCCGGCGG - Intronic
1149541600 17:57471944-57471966 ACTCAGAGGCTTCCTGCCTGAGG + Intronic
1150635834 17:66912572-66912594 GCTCAGGGGCTGGGTCTCGGTGG - Intergenic
1151802244 17:76385241-76385263 GCTCCGGGGCTTTCTCCCTGGGG - Intronic
1153377761 18:4400148-4400170 GCTCAGGGGCGTGCTGCAGGTGG - Intronic
1154370831 18:13761852-13761874 ACACAGGGGCTTGGGGCCGGGGG - Exonic
1158303417 18:56078132-56078154 ACTCAGGCGGCTGCTCCAGGAGG + Intergenic
1160915149 19:1492884-1492906 GGTCAGGGACCTGCTCCCGGGGG - Intronic
1163532759 19:17860200-17860222 ACTCCGGGTCTTCTTCCCGGGGG + Intronic
1165009084 19:32830622-32830644 ACTCAGGGTCTTCCTCCGGTGGG + Exonic
1165548286 19:36561164-36561186 ACTTTGGGGCTTGCTGCCCGGGG + Intronic
1167149735 19:47701841-47701863 GCCCAGGGGCTTGCGCTCGGGGG - Exonic
1168125675 19:54281235-54281257 ACTCAGAGGTTTCTTCCCGGGGG - Intergenic
1168176298 19:54630339-54630361 ACTCAGAGATTTGTTCCCGGGGG + Intronic
927158529 2:20236374-20236396 ACACAGGGCCTGGCTCCTGGTGG - Intergenic
930252856 2:49054617-49054639 ACTCAGGGTCTGGCTCACTGGGG - Intronic
932448624 2:71795727-71795749 ACCCAGGGGGTTCCTCCTGGAGG - Intergenic
934524615 2:95043858-95043880 AGCCAGGGGTTTGCTCCCAGGGG - Intronic
935194374 2:100803562-100803584 ACACAGGGGCTTGTTCCCATTGG + Intergenic
935748001 2:106206070-106206092 ACTCAGGGGCTTGGTGTCAGGGG + Intergenic
936059724 2:109286540-109286562 AGCCAGGGGTTTGCTCCAGGTGG + Intronic
936122128 2:109756018-109756040 ACTCAGGGGCTTGGTGTCAGGGG - Intergenic
936222566 2:110615456-110615478 ACTCAGGGGCTTGGTGTCAGGGG + Intergenic
937914571 2:127092586-127092608 GCTCAGGGGCATGCTGCAGGGGG + Intronic
948076258 2:235167419-235167441 ATTCAGCGGCTTTCTCCTGGAGG + Intergenic
948603923 2:239122916-239122938 CCCCAGGGGCTTGTTCCCTGAGG - Intronic
1170787393 20:19479490-19479512 ACTCAGGGGTTTGCTCCTTGGGG - Intronic
1172309516 20:33906925-33906947 ACTCAGGGGCTGACACCCTGTGG - Intergenic
1175228654 20:57460067-57460089 ACTCAGGGTCTTGCCCCAGGTGG - Intergenic
1176862269 21:14017304-14017326 TCTAAGGGGCTTGCTCTGGGGGG - Intergenic
1178011036 21:28287584-28287606 ACTCGAGGGCTTGCTGCAGGTGG - Intergenic
1183041120 22:35178665-35178687 ACTCTGGGGCCAGCTCCGGGAGG + Intergenic
1184357766 22:43994100-43994122 GCTCAGGGACCTGCTCCAGGGGG - Intronic
956623545 3:71245173-71245195 AGTTAGGAGCTTTCTCCCGGAGG + Intronic
958547087 3:95567539-95567561 ACCCAGGGGATTGCCCCCAGTGG - Intergenic
958691443 3:97472615-97472637 ACTCAGGAGCTTGGTCCTGATGG - Intronic
962814425 3:138985848-138985870 ATTCAGGGGCTTGCTACAGTTGG - Intergenic
966853952 3:184181402-184181424 ACAAAGGGGCTTGCTCTCTGAGG - Intronic
967007086 3:185394300-185394322 ACTCAGGGACTTGTACCCAGAGG - Intronic
969987274 4:11225346-11225368 ACTCAGGGGCTTGCATCAGCTGG - Intergenic
975995733 4:80311575-80311597 ACTTAGTGGGTTGCTCCTGGTGG - Intronic
982388549 4:154838900-154838922 ACTCTGGGCCTGGCTTCCGGTGG + Intergenic
985223030 4:187728116-187728138 ACTCTGTGGCTTGCTCCAGTTGG + Intergenic
987053250 5:14166126-14166148 ATTTAGGGGGATGCTCCCGGTGG + Intronic
988855902 5:35228301-35228323 ACTCAGAGGCTTGCTCAGTGTGG + Intronic
996573415 5:124957603-124957625 ATTCAGGTGGTTGCTCCTGGTGG + Intergenic
997739662 5:136242503-136242525 ACTTTGGGGCTTGCTCCCACTGG + Intronic
1000975968 5:167764776-167764798 ACTCAGGGGAGAGCTCCCCGTGG - Intronic
1002603882 5:180370658-180370680 ACTCAGGTGCCTGCTCCTGCTGG + Intergenic
1004303172 6:14476658-14476680 ACTCATGGGTGGGCTCCCGGTGG + Intergenic
1006508810 6:34510386-34510408 AGGCAGGGGCTGGCTCCCAGAGG - Intronic
1008625472 6:53311361-53311383 ACTCAGGCGCTTGCTGTTGGCGG + Intronic
1018837620 6:167497068-167497090 ACTCTGGGACTTGCCCCTGGGGG + Intergenic
1019157401 6:170048594-170048616 ACTCTGGGGACTGGTCCCGGTGG + Intergenic
1020800820 7:12730085-12730107 ACTCAGAGGTTTTCTCCAGGGGG - Intergenic
1024508233 7:50181402-50181424 ACTCAGCAGCTTCCTCCCTGAGG - Intergenic
1029563786 7:101321570-101321592 GATCTGCGGCTTGCTCCCGGAGG - Intronic
1030301346 7:107977333-107977355 TCTCAGGGGTTTTCTCCGGGTGG - Intronic
1037877356 8:22554580-22554602 ACATAGGGTCTTCCTCCCGGGGG + Exonic
1039385737 8:37134171-37134193 ACTGAGGTGCTTCCTCCAGGTGG - Intergenic
1041309959 8:56506483-56506505 GCTCAGGAGCTTCCTCCCAGTGG - Intergenic
1042242976 8:66683152-66683174 AGACAGGGGCTAGCTCCCAGAGG + Intronic
1059788734 9:117616638-117616660 ACCTAGGGGCTTGCTGCAGGAGG - Intergenic
1060962087 9:127688184-127688206 AGTCAGGTGCTTGCTCAGGGTGG - Intronic
1062619366 9:137412594-137412616 CCTCTGGGGGCTGCTCCCGGGGG - Intronic
1062647568 9:137556679-137556701 CCCCAGGGGCTTCCTCCCGAGGG - Intronic
1191815646 X:65241524-65241546 ACTCAGGGGCGACCTCCCTGTGG - Intergenic
1200210034 X:154342976-154342998 ACCCAGCGGCCGGCTCCCGGGGG - Intergenic
1200220818 X:154389116-154389138 ACCCAGCGGCCGGCTCCCGGGGG + Intergenic