ID: 901879987

View in Genome Browser
Species Human (GRCh38)
Location 1:12188213-12188235
Sequence ACATACCCACAGGGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901879981_901879987 26 Left 901879981 1:12188164-12188186 CCTCTGCTGTCTGCATCACATGA 0: 1
1: 0
2: 1
3: 17
4: 207
Right 901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 159
901879980_901879987 29 Left 901879980 1:12188161-12188183 CCACCTCTGCTGTCTGCATCACA 0: 1
1: 0
2: 3
3: 29
4: 348
Right 901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901879987 Original CRISPR ACATACCCACAGGGGGTGGA AGG Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902538600 1:17136508-17136530 AGATCCCCACAGGTGGTGGAAGG - Intergenic
904640010 1:31919038-31919060 AGATCTCCACAGGGGCTGGACGG + Exonic
906200799 1:43958937-43958959 ACATTCCCACAGGTGGGGGTTGG - Intronic
906667606 1:47632502-47632524 ACAAGCCCACAGGGGGAGAAGGG + Intergenic
907929268 1:58984145-58984167 ACACACACACACGGGGTGGCAGG + Intergenic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
908788905 1:67761745-67761767 ACATACCCTCAGGGAGGGTAAGG - Intronic
912920973 1:113866828-113866850 ACTTGACCCCAGGGGGTGGAGGG - Intronic
913038874 1:115003946-115003968 ACATAACCACAGTGGGTTAATGG - Intergenic
914858869 1:151370711-151370733 GAATACCCAGAGGGGGTGGCAGG + Intronic
916534112 1:165687130-165687152 ACACACACACAGGGGGTGGGAGG + Intronic
916691743 1:167196355-167196377 ACAAAACCACAGGGGGTTGGAGG + Intergenic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
1062961706 10:1577348-1577370 TCATGCACACAGGAGGTGGATGG + Intronic
1064133476 10:12730497-12730519 AGATACACATTGGGGGTGGAGGG + Intronic
1064218369 10:13418951-13418973 CCATACCCTCAGGGGCTGGGAGG + Intergenic
1070737140 10:78870865-78870887 ACATTCCCACAGGGGTTGGTTGG - Intergenic
1072006439 10:91254193-91254215 ACACACACACACGAGGTGGAGGG - Intronic
1072545123 10:96431473-96431495 ACAGAGCCACAGGGAGGGGAAGG + Intronic
1076131753 10:128018336-128018358 CCAGACCCCCAGGGGCTGGATGG + Intronic
1077183989 11:1228409-1228431 GCATGGCCACAGTGGGTGGAAGG + Intronic
1077529525 11:3088612-3088634 CCATAACCACAGGGGTGGGAGGG - Intronic
1077557319 11:3231876-3231898 ACAGAGCCACCGGGGGTGGGGGG + Intronic
1079940772 11:26677891-26677913 ACATACTCCAAGGAGGTGGAGGG + Intronic
1080518888 11:33049358-33049380 AAACACCCACAGGTTGTGGAGGG - Intronic
1081529415 11:43947774-43947796 AGAGACCCACAGGGGTAGGAAGG + Intergenic
1083040652 11:59682098-59682120 AAACACCCACAGGTTGTGGAGGG + Intergenic
1085056025 11:73404516-73404538 ACAAAACCAAAGAGGGTGGAAGG + Intronic
1087022160 11:93614577-93614599 AGATACCAGCTGGGGGTGGAAGG - Intergenic
1091248826 11:134124300-134124322 AAATCTCCACAGGGGCTGGACGG + Intronic
1091270782 11:134310436-134310458 ACACACCCACGTGGGATGGAAGG + Intronic
1091793408 12:3284135-3284157 GAATACCCACATGGGGTGGAAGG - Exonic
1091988358 12:4932843-4932865 ACAAACGCACAGGGGGAAGACGG - Intergenic
1095361404 12:41345325-41345347 ACACACCGACAGGAGGGGGAGGG - Intronic
1095389808 12:41692457-41692479 ACACAACCACAGGGACTGGAAGG - Intergenic
1095957550 12:47815331-47815353 ACACACACACAGGGGGTACATGG + Intronic
1098590257 12:72202652-72202674 AGATTCCCACAGGAAGTGGATGG - Intronic
1101867180 12:108528753-108528775 ACATACCTACAGGGGCCGGGTGG + Intronic
1105334985 13:19459408-19459430 ACATACCTGCAGGAGGTGGCTGG + Intronic
1105859938 13:24399982-24400004 ACATACCTGCAGGAGGTGGCTGG - Intergenic
1106518489 13:30475807-30475829 ACATTTCCACATGGGGAGGATGG + Intronic
1121531263 14:94655532-94655554 ACACACACACTGGGGGTGGGAGG + Intergenic
1126932426 15:53669368-53669390 ACTTAGCCCTAGGGGGTGGAGGG + Intronic
1127330972 15:57939953-57939975 ACATACCTATAGGAGGTGGCTGG + Intergenic
1128795417 15:70463066-70463088 ACACACACACAAGGGTTGGAAGG + Intergenic
1130851393 15:87797700-87797722 GAACACCCACAGGGTGTGGAAGG - Intergenic
1131379665 15:91953573-91953595 ACAGAACTACAGGGCGTGGAAGG + Intronic
1131712265 15:95068582-95068604 AAATGCCCACCTGGGGTGGAAGG - Intergenic
1136651509 16:31677214-31677236 ACATACACACAGGGGGGCTATGG - Intergenic
1137253281 16:46755741-46755763 ACATACCCTCATGGAGTGGTCGG + Intronic
1138219620 16:55239855-55239877 ACATCCCCACAGGGTGGGGAAGG - Intergenic
1140061314 16:71572221-71572243 ACTGACCCACAGGGGTTTGATGG + Exonic
1140261340 16:73383078-73383100 ACATCCCCACATGGGGAGGAGGG + Intergenic
1140803035 16:78506436-78506458 ATATACCTTCCGGGGGTGGAGGG - Intronic
1143573124 17:7773469-7773491 ACATATCCCCAGTGGGTGGGGGG - Intronic
1145240885 17:21240620-21240642 ACAAACCCACAGGGTGAGGCGGG + Exonic
1145741265 17:27276702-27276724 ACATATCCACAGGGGATGCTGGG - Intergenic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1150459369 17:65334781-65334803 AGATACACACAGGGAATGGAGGG - Intergenic
1151850217 17:76685564-76685586 CAATAGCCACAGGGGGTGGGGGG - Intronic
1153018358 18:604913-604935 ACATACGCACTGGGGGAGGGCGG - Intronic
1155142902 18:23059273-23059295 TCATACCCAAAGTGGGAGGAGGG - Intergenic
1155385695 18:25274965-25274987 TCATCCCCAAAGCGGGTGGAGGG + Intronic
1160233615 18:77068006-77068028 ACACACACACACGGGATGGAGGG - Intronic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165329820 19:35135277-35135299 ACAGCCCCACAGGAGGGGGAGGG + Intronic
1166214777 19:41327826-41327848 ACAGCCCCACAGGGCGGGGAGGG - Intronic
1167831567 19:52027133-52027155 AAACACCCACAGGTTGTGGAGGG + Intronic
1167834137 19:52052655-52052677 AAACACCCACAGGCTGTGGAGGG + Intronic
1168475281 19:56670636-56670658 ACACACCCACAGGGGATGGCTGG + Intronic
925309819 2:2874644-2874666 ACAGTCCCACAGTGGGTGCAAGG + Intergenic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
927214771 2:20662063-20662085 CCAGACCCAGAGAGGGTGGATGG + Intergenic
928065858 2:28163844-28163866 AAACACCCACAAGGGGTGGATGG - Intronic
929505515 2:42525106-42525128 AGAGACCCACAGGTGGGGGAGGG - Intronic
931193738 2:60029939-60029961 CCATATCCACACGGGGTGCAGGG - Intergenic
932466099 2:71925421-71925443 ACATACCCCCAGGGGAAGAAAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
941605849 2:167595476-167595498 ACATACACACATGTGGAGGAAGG - Intergenic
941835690 2:170017573-170017595 ACACACACACAGGGGGAGAAGGG + Intronic
942309685 2:174644157-174644179 ACATACACAGCTGGGGTGGAGGG - Intronic
946067835 2:217004722-217004744 ACATATCCACAGAGAGTGGCTGG - Intergenic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
1169591914 20:7153001-7153023 ACATAAACATAGGGGGTAGATGG + Intergenic
1173112522 20:40205633-40205655 ATAAACCCACATGGAGTGGATGG - Intergenic
1173122332 20:40305376-40305398 ACAGACCCACAATGGGTGCAGGG - Intergenic
1173262871 20:41452036-41452058 ACATACAGACAGGTGTTGGAGGG + Intronic
1173398386 20:42702157-42702179 ACACTCCCACAGGAGGTGGGAGG - Intronic
1173895751 20:46549563-46549585 ACATTCCAGCTGGGGGTGGAAGG + Intronic
1174240896 20:49133734-49133756 TCTTACCCACTGAGGGTGGAGGG + Intronic
1175753914 20:61517299-61517321 ACAGCCCCACAGGAGGTGGGAGG - Intronic
1178819499 21:35962382-35962404 ACCCACCCACAGAAGGTGGAGGG - Intronic
1178890864 21:36520183-36520205 ACAGACCCACAGAGGGAAGACGG - Intronic
1179150078 21:38802291-38802313 TCATGCCCACAGGGAGTGCAAGG + Intergenic
1179250050 21:39664717-39664739 ACCCAGCCACAGGGGGTGGTGGG - Exonic
1179808686 21:43856242-43856264 ACGCCCCCACAGGGGCTGGAAGG + Intergenic
1179964742 21:44795864-44795886 ACATGCACACAGGGGGAAGATGG + Intronic
1180182443 21:46124029-46124051 ACAGACGGACAGTGGGTGGATGG + Intronic
1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG + Exonic
1182373356 22:29828002-29828024 ACAATCCCACAGGGGGAAGATGG + Intronic
1185110598 22:48898162-48898184 ACAAACCCACAGGGGGTCAAGGG - Intergenic
1185203597 22:49523595-49523617 ACAGACCCAGAGGGAGTTGATGG - Intronic
1185337411 22:50276780-50276802 ACCTCCCCGCAGGGGGTCGAGGG + Intronic
949550059 3:5105121-5105143 AGATACCCCCAGGAGGGGGAGGG - Intergenic
949931022 3:9078453-9078475 ACATACTCACGGTGGGGGGAAGG - Intronic
949980848 3:9500892-9500914 ACGCCCCCACAGTGGGTGGAGGG + Exonic
955216050 3:56985825-56985847 ACATACCCACAGGTGGGGCTGGG + Intronic
956462224 3:69484274-69484296 AGATTCCCACAGGGGCTGGATGG + Intronic
956725418 3:72152707-72152729 ACCAATCCACAGGGGGTGAAGGG + Intergenic
957501699 3:81066470-81066492 AAATACCCATTGGGGGTGGTCGG - Intergenic
962242931 3:133766587-133766609 ACATAGCAACAAGGGCTGGAAGG + Intronic
964364450 3:155934440-155934462 AGATACCCACAGGGGAATGAGGG - Intronic
965095272 3:164217544-164217566 ACTTACACACAGTGGGAGGATGG + Intergenic
965132377 3:164717571-164717593 ACATATTGACAGGCGGTGGAAGG - Intergenic
970270961 4:14347255-14347277 ACCTACCAACAGGGCTTGGAAGG - Intergenic
971921766 4:32949655-32949677 ACATACCCACAGGTGGTATTTGG - Intergenic
974083303 4:57234430-57234452 ACATGCCCACAGGCGGCAGAGGG + Intergenic
976484061 4:85580101-85580123 ACACATACACAGGGTGTGGAGGG - Intronic
976493154 4:85694652-85694674 ACACACACACAGAGGGTGGAGGG - Intronic
976928040 4:90526555-90526577 ACATAGACACAGGTGGGGGATGG - Intronic
977045167 4:92060609-92060631 ACATACCCACTGGGGCTTTAGGG - Intergenic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
977354459 4:95927308-95927330 ACACACACACAGAGGGTGGTGGG + Intergenic
977400376 4:96524120-96524142 AAACACCCACAGGTTGTGGAGGG - Intergenic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
985670232 5:1203130-1203152 ACATCCCCACTGGGGATGGAGGG + Intronic
987520702 5:18979625-18979647 ACATACCAACAGAGAGTAGAAGG - Intergenic
987545438 5:19306127-19306149 CCATACCCTGAGGGAGTGGAGGG + Intergenic
988454956 5:31379270-31379292 ACACACCCAGAAGGGGAGGACGG + Intergenic
991970665 5:72138208-72138230 ACATACACACAGAAGGTGGGTGG + Intronic
992413083 5:76526611-76526633 TCATGCCCAAATGGGGTGGATGG - Intronic
998268988 5:140690153-140690175 ACATAACCACATGTGGTGGCCGG + Intronic
999172411 5:149606593-149606615 AGTTACCTACAGAGGGTGGACGG - Intronic
999263488 5:150251865-150251887 TCCTCCCCACAGGGGGTTGAAGG - Intronic
999508834 5:152226613-152226635 ACACACACACACGGGGTGGGGGG + Intergenic
1006054198 6:31369050-31369072 ACAAACCCATAGGAGGTGGGGGG + Intergenic
1006687998 6:35853784-35853806 ACTTTCCCACAGTGGGAGGAAGG + Intronic
1009404009 6:63290919-63290941 AAATACCCACAGGGGCCAGACGG - Intronic
1012419385 6:99046701-99046723 ACATTCCCACAGAGTGTGAAAGG + Intergenic
1017790066 6:157790143-157790165 ACATGGCCACAGGGAGTGCAAGG + Intronic
1022430389 7:30313805-30313827 ACATCACCACTGGGGGAGGAAGG - Intronic
1023659076 7:42454842-42454864 AGAGAGCCACAGGGGATGGATGG + Intergenic
1024122702 7:46260995-46261017 CCATGGCCACAGGGTGTGGAAGG + Intergenic
1024233787 7:47382674-47382696 GTATACTCACAGGGGGTGGTGGG - Intronic
1025848236 7:65219140-65219162 ACATTCCCCCAGGAGGTGAAGGG + Intergenic
1026368083 7:69670106-69670128 ACATACAGTCTGGGGGTGGAAGG - Intronic
1029520588 7:101059083-101059105 ACATACACACAGAGGGGGGGGGG + Intergenic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1033307976 7:140238935-140238957 TCCTACTCTCAGGGGGTGGATGG - Intergenic
1033444060 7:141404958-141404980 ACATACTGCAAGGGGGTGGACGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035708319 8:1694648-1694670 ACACACCCCCCGGGGTTGGATGG - Intronic
1037598277 8:20372779-20372801 GCATGCCCACAGGGGCAGGAGGG + Intergenic
1042090069 8:65149260-65149282 ACATGCTCACAGGGAGGGGAAGG - Intergenic
1043863722 8:85352164-85352186 ACCTAACCTCAAGGGGTGGATGG + Intronic
1049756868 8:144314658-144314680 ATATACACACAGTGGATGGACGG + Exonic
1053878679 9:42568972-42568994 ACAAAACCAGAGGCGGTGGAAGG + Intergenic
1054233009 9:62532723-62532745 ACAAAACCAGAGGCGGTGGAAGG - Intergenic
1054996866 9:71401277-71401299 ACAAACACACGTGGGGTGGAAGG + Intronic
1055713984 9:79097475-79097497 ACACACTCTCAGAGGGTGGAGGG - Intergenic
1055951938 9:81737559-81737581 ACATACCCAGTGTGGGTGAATGG - Intergenic
1059361217 9:113743318-113743340 ACATTCCAACAGGGGTGGGAGGG - Intergenic
1061010361 9:127950953-127950975 ACACCCCCACAGGGGTTGGGAGG + Intronic
1061631601 9:131875520-131875542 GCCTGCCCACAGGGGATGGAGGG + Intronic
1062219093 9:135404705-135404727 ACAAATCCCCAGGGAGTGGAGGG - Intergenic
1186730717 X:12406521-12406543 ACCTACCCAGAGTGGTTGGAGGG - Intronic
1189553478 X:42117288-42117310 ATATATCCACAGGGGGTTGGGGG - Intergenic
1189633968 X:42985373-42985395 ACGTGCCCATAGTGGGTGGATGG + Intergenic
1190157325 X:48004536-48004558 ACACACACACCGGGGGTGAAGGG + Intronic
1190173095 X:48127421-48127443 ACACACACACCGGGGGTGAAGGG + Intergenic
1191227932 X:58065337-58065359 AAACACCCACAGGTTGTGGAGGG - Intergenic
1195915256 X:109929111-109929133 ACATATCCACAGGGTGTCGTGGG - Intergenic
1201172933 Y:11287612-11287634 TCATACCCTCAGAGGGTAGAGGG - Intergenic
1201935674 Y:19408351-19408373 GCAAACCCACATGTGGTGGATGG + Intergenic