ID: 901882902

View in Genome Browser
Species Human (GRCh38)
Location 1:12204391-12204413
Sequence AAACAGCCCCAAGCATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901882902_901882905 14 Left 901882902 1:12204391-12204413 CCACCACATGCTTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 901882905 1:12204428-12204450 TGCCAGCTCCATCCACCTCCCGG 0: 1
1: 1
2: 15
3: 86
4: 540
901882902_901882904 -10 Left 901882902 1:12204391-12204413 CCACCACATGCTTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 901882904 1:12204404-12204426 GGGGCTGTTTTGAGCACAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901882902 Original CRISPR AAACAGCCCCAAGCATGTGG TGG (reversed) Intronic