ID: 901882902

View in Genome Browser
Species Human (GRCh38)
Location 1:12204391-12204413
Sequence AAACAGCCCCAAGCATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901882902_901882904 -10 Left 901882902 1:12204391-12204413 CCACCACATGCTTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 901882904 1:12204404-12204426 GGGGCTGTTTTGAGCACAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 306
901882902_901882905 14 Left 901882902 1:12204391-12204413 CCACCACATGCTTGGGGCTGTTT 0: 1
1: 0
2: 0
3: 14
4: 169
Right 901882905 1:12204428-12204450 TGCCAGCTCCATCCACCTCCCGG 0: 1
1: 1
2: 15
3: 86
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901882902 Original CRISPR AAACAGCCCCAAGCATGTGG TGG (reversed) Intronic
901882902 1:12204391-12204413 AAACAGCCCCAAGCATGTGGTGG - Intronic
902636373 1:17737408-17737430 ACACAGCTCAAAGAATGTGGAGG + Intergenic
907000324 1:50846299-50846321 AAACAGACTCATGCATGAGGGGG + Intronic
908449374 1:64236696-64236718 AAACAGCCTGAAGCATGATGGGG + Intronic
909747045 1:79110211-79110233 AAAAAGCCCCAATCATTTGAAGG - Intergenic
918165061 1:181937083-181937105 AAATGGCCCCTAGCTTGTGGAGG - Intergenic
918245997 1:182659884-182659906 AAACCTCCCCATGCATGTGAGGG - Intronic
920039746 1:203087719-203087741 AAAGAACCCTAAGCATGTTGAGG + Intergenic
923958596 1:239051374-239051396 ACAGAGCCCCATGGATGTGGAGG - Intergenic
924436137 1:244044928-244044950 TAACAGCCCCAAAGATATGGAGG - Intergenic
924436249 1:244046534-244046556 TAACAGCCCCAAAGATATGGAGG - Intergenic
1062913688 10:1231208-1231230 CACCAACCCCAAGCATTTGGCGG + Intronic
1063433025 10:6007709-6007731 CAACAGCCCCACTGATGTGGTGG + Intergenic
1069807460 10:71134838-71134860 ACAGAGCTCCAAGCAAGTGGGGG - Intergenic
1072888088 10:99297840-99297862 AAATACCCCAAAGCATCTGGAGG - Intergenic
1074529344 10:114286414-114286436 AGGCAGCCCAAAGCATGTGATGG + Exonic
1077178075 11:1199582-1199604 GGACAGCCCCAAGCAGGAGGGGG - Intronic
1077633473 11:3826410-3826432 AAACAGGCTCAAGAATGGGGAGG + Intergenic
1085479887 11:76812634-76812656 ATACAGTTCCAAGAATGTGGAGG + Intergenic
1088864444 11:113834020-113834042 AAACAGCTCCAAGAATATGTGGG - Intronic
1089290301 11:117433625-117433647 AAACAGCCCAAAACATGACGCGG + Intronic
1089679498 11:120111374-120111396 CAACAGCCCCAGGCCTATGGGGG - Exonic
1090044084 11:123315690-123315712 AAACAGTGGCAGGCATGTGGCGG + Intergenic
1090870132 11:130737281-130737303 AAACACCACCCAGCAGGTGGGGG - Intergenic
1091993958 12:4978350-4978372 AAACAGCCCCAGCCACGTAGTGG + Intergenic
1092621100 12:10269710-10269732 AAACAACCCAAAACATATGGAGG - Intergenic
1095348890 12:41187250-41187272 AAACCCACCCAAGCATCTGGTGG + Intergenic
1098070392 12:66668466-66668488 AAACAGCACCAGGCAGCTGGAGG - Intronic
1098458769 12:70708067-70708089 AAAGAGCCCCTGGCATTTGGAGG - Intronic
1098627283 12:72687894-72687916 AAACAGTCCAAAGAATGTGATGG - Intergenic
1101894535 12:108745965-108745987 ACTCAGCCCCCAGCATATGGTGG - Intergenic
1101988166 12:109463494-109463516 AAGCAGCTCCTCGCATGTGGGGG + Intronic
1102201575 12:111061056-111061078 GAACAGCCCCAAGGAAGCGGGGG - Intronic
1103033132 12:117634076-117634098 GCCCAGCCCCTAGCATGTGGTGG + Intronic
1103640458 12:122347329-122347351 AAGCAGACCCATGCATGTGAAGG - Intronic
1107817957 13:44261197-44261219 ACACAGCCCCTAGCATCTGGGGG + Intergenic
1110147699 13:72212383-72212405 AAAAATACCCAAGCAAGTGGGGG - Intergenic
1111078248 13:83266751-83266773 AAACAGCACAAAGAAGGTGGTGG - Intergenic
1112856028 13:103770259-103770281 AAACTGCCTCAACCATTTGGAGG - Intergenic
1113736326 13:112680964-112680986 ATCCAGCCACAAGCCTGTGGTGG + Intronic
1120682190 14:87493401-87493423 ATATAGCCCCACGCATGTGTGGG + Intergenic
1122211241 14:100175459-100175481 AAACACACCCAAGCAGGTGCAGG + Intergenic
1122796219 14:104207515-104207537 ACACAGCCCCAGCCATTTGGGGG + Intergenic
1124028536 15:25989083-25989105 AAACGGCCCCAAGCATAGTGTGG - Intergenic
1126127648 15:45310379-45310401 AAAAAGCCCCACGGGTGTGGTGG + Intergenic
1128062336 15:64742904-64742926 AAACAGCACCTAGAATTTGGCGG - Intronic
1128265396 15:66262005-66262027 AAACAGCGCCAAGTTTGTTGGGG + Intergenic
1128287861 15:66453247-66453269 AGAAAGCCCTAAGCAGGTGGGGG - Intronic
1129170479 15:73804509-73804531 CACCAGCTCCAAGCATCTGGAGG + Intergenic
1130965419 15:88694115-88694137 AAACAGTGCCTAGCATGTAGTGG - Intergenic
1133124020 16:3633039-3633061 AATAAGACCCAAGCATGTGTTGG - Intronic
1134075838 16:11290708-11290730 ACACAGGCCCAAGGCTGTGGAGG + Intronic
1134364366 16:13563173-13563195 CAACAGCTCCTTGCATGTGGTGG + Intergenic
1134627022 16:15729488-15729510 AATGAACCCCAAGCATGGGGAGG + Intronic
1135207051 16:20492660-20492682 AGACACCCCCAAGCCTGTGGAGG - Intergenic
1135207072 16:20492727-20492749 AGACACCCCCAAGCCTGTGGAGG - Intergenic
1135211813 16:20530905-20530927 AGACACCCCCAAGCCTGTGGAGG + Intergenic
1135211834 16:20530972-20530994 AGACACCCCCAAGCCTGTGGAGG + Intergenic
1138921396 16:61533877-61533899 GAACAGGCCCAAGAAAGTGGGGG + Intergenic
1139598656 16:67972790-67972812 AAACAGAAAAAAGCATGTGGTGG + Intergenic
1140150251 16:72355760-72355782 AGACAGACTCAAGCATGTGTGGG + Intergenic
1143372637 17:6449827-6449849 AAACAGCCCCAAGTTAGGGGAGG - Intronic
1143839934 17:9724076-9724098 AAACAGCAACACGCATGAGGGGG - Intronic
1144237492 17:13275756-13275778 AATCAGCCCCGCACATGTGGAGG + Intergenic
1144827736 17:18115805-18115827 GCACAGTCCCAAGCAGGTGGAGG - Intronic
1146134024 17:30302743-30302765 AAATAGCCACAAGCATCTAGCGG - Intergenic
1146474884 17:33154728-33154750 AAAAAGCTCCAAGCATGTTTGGG - Intronic
1152087203 17:78227507-78227529 AAAGAGCCCTTAGAATGTGGGGG + Intergenic
1152158016 17:78647652-78647674 AAACTGCCCCCAGCAGGTGCTGG - Intergenic
1152335075 17:79696097-79696119 AAACAGCCCCAAGCCTGAGATGG + Intergenic
1152522790 17:80869480-80869502 AAACACCCCCAAAAATGTGGGGG + Intronic
1153776436 18:8458302-8458324 CAACAGCCCTGAGCATTTGGTGG - Intergenic
1154381524 18:13855145-13855167 AAACAGCCCAAAGCCTGGGAAGG + Intergenic
1155187997 18:23404382-23404404 AAACAGCCCCAGGCAAGGCGCGG + Intronic
1157601433 18:48895371-48895393 TAACAGACCCAATCATGGGGAGG + Intergenic
1160134939 18:76263774-76263796 TAAAAGCCCCAAGCCTTTGGTGG + Intergenic
1160373814 18:78395944-78395966 AAACAGACCTGGGCATGTGGTGG + Intergenic
1161439155 19:4280498-4280520 AGACTTCCCCAAGCAGGTGGAGG - Intronic
1161874546 19:6897754-6897776 AAAAAGACCCAACCATGTGCTGG - Intronic
1164544306 19:29146418-29146440 AAAAAGCCCCAAGCTTGAGCTGG - Intergenic
1164728397 19:30482923-30482945 ATACAGCACCAAGCAAGGGGTGG - Intronic
1165822535 19:38685666-38685688 AAACAAGCCCAAGTCTGTGGGGG + Intronic
1165977088 19:39685661-39685683 AGACAGCCCAAATCATGGGGAGG + Intergenic
1166314310 19:41980284-41980306 AAACAGGGCCTAACATGTGGTGG + Intronic
925697602 2:6597362-6597384 AAACTGCCTCAGGGATGTGGGGG - Intergenic
926558108 2:14383587-14383609 AAACAGACTCAAGCATATGTGGG + Intergenic
931953357 2:67390180-67390202 AAACTGCCCCAAGCATTTATAGG + Intergenic
932617580 2:73244260-73244282 AAACAGCCCCAGGCACATAGAGG - Intronic
933924410 2:87077806-87077828 GAACAGCCCCTGGCATGAGGTGG + Intergenic
935378016 2:102420456-102420478 AATCAGCCCCAGGCAGCTGGAGG + Intronic
935677183 2:105605438-105605460 AAGCAGCCTCAGGCATATGGAGG + Intergenic
936050167 2:109216558-109216580 ACACAGCCCGAAGCCTGAGGTGG + Intronic
937332981 2:121043746-121043768 CAACCTCCCCAAGCAGGTGGTGG + Intergenic
940237752 2:151529176-151529198 AAACTTCCCCAAGCATGGTGGGG - Intronic
947859646 2:233349389-233349411 AGACAGCCCCACACATGTGCAGG - Intergenic
1168969892 20:1923801-1923823 ACACAGCCAGAAGCAAGTGGAGG - Intronic
1169274017 20:4221180-4221202 AGACAGCCCCAAGCATGGCCAGG - Exonic
1172495913 20:35384099-35384121 AGCCAGTCCCGAGCATGTGGTGG - Exonic
1175855828 20:62120530-62120552 ATGCGGCCCCAAGCCTGTGGAGG + Intergenic
1175904067 20:62371269-62371291 GAAGAGCCCCAAGTCTGTGGAGG - Intergenic
1178065839 21:28903520-28903542 AACCAGCGCCAAGTGTGTGGAGG - Intergenic
1178570927 21:33736538-33736560 CAACGGCCCCAGTCATGTGGAGG - Intronic
1181055791 22:20260022-20260044 AAACTGCACCAAGGATGAGGAGG + Intronic
1183190121 22:36316772-36316794 GAACAGCCCTAAGTATGTGGGGG + Intronic
1183643340 22:39106631-39106653 GAACAGTTCCAAGAATGTGGAGG - Intergenic
1184003887 22:41694883-41694905 AAGAAGACCCAAGCATCTGGGGG + Exonic
1184279640 22:43429676-43429698 ATGCAGCCCCATGCTTGTGGAGG - Intronic
1184329662 22:43819317-43819339 AACCAGCCCAAGGCATGTGGTGG + Intergenic
950159837 3:10752110-10752132 AAAGAGCCACAGGCATGGGGAGG - Intergenic
950777470 3:15363007-15363029 ACACAGCCCTGAGCATGTGAGGG + Intergenic
951202578 3:19891449-19891471 AAACAGGCCCAGGCATTTAGAGG - Intronic
952973604 3:38674164-38674186 AAACAGGCCCAAGTATGTATAGG + Intergenic
953343147 3:42152627-42152649 AAGCAGCCTCAGGCATGGGGAGG + Intronic
953739457 3:45524573-45524595 TAACAGTCCCAATGATGTGGAGG - Intronic
953786444 3:45915151-45915173 AAGCTGCCCCATGCATCTGGTGG - Intronic
954775900 3:53018347-53018369 AAACAGATCCAGGCAGGTGGTGG - Intronic
956777691 3:72579157-72579179 AGACAGCCCCATGCACGTGGTGG + Intergenic
957423540 3:80004800-80004822 AAGCTGCCCCAAGCAAGTGTGGG + Intergenic
958482912 3:94667045-94667067 CAACAACCCCAAGCAGGTAGGGG + Intergenic
958722324 3:97859389-97859411 AAGCAGCCCGTAGCATGTGATGG - Intronic
961726750 3:128935733-128935755 AAACAAGCCCAGGCAGGTGGAGG + Intronic
961887992 3:130108867-130108889 AAACAGCTTCTAGCATTTGGTGG - Intronic
962529693 3:136267470-136267492 CCACTGCCCCAAGCCTGTGGTGG + Intronic
965774470 3:172214100-172214122 AAACACCCCCAAGCAATTGTGGG - Intronic
967086846 3:186102886-186102908 CAACAGCCAGAAGCATGAGGAGG - Intronic
967890681 3:194362291-194362313 CAACAGCCCCAAGAACGGGGCGG - Intronic
969451035 4:7273531-7273553 AATCAGCCCTCAGCATGTGGGGG + Intronic
975608092 4:76176113-76176135 AAATAGCCCAAAACATGTGGTGG + Intronic
981468741 4:145103912-145103934 AAAGAACCCCAGACATGTGGTGG - Intronic
981723091 4:147821032-147821054 AAACAGCCTCATGCATGTACAGG + Intronic
985996784 5:3601280-3601302 AAAGAGACACAAGCACGTGGGGG - Exonic
990795392 5:59534438-59534460 AGACAGCCTCAAGGATCTGGTGG + Intronic
992427362 5:76671533-76671555 AAGTAGCCCCGGGCATGTGGTGG + Intronic
993003078 5:82402488-82402510 AAACAGCCAAAGGCATTTGGAGG + Intergenic
998878770 5:146626605-146626627 AAGCAGCCACAAGCACCTGGGGG - Intronic
1001273334 5:170332003-170332025 AACCACCCCCAAGGATTTGGTGG - Intergenic
1002716469 5:181231202-181231224 GAGCAGCCCTAAGCATGAGGCGG + Intronic
1004761056 6:18666472-18666494 AAACAGCAGCAAGGTTGTGGGGG - Intergenic
1006147666 6:31969074-31969096 AAACACCCTCAAGCAGGTAGGGG + Exonic
1006412872 6:33885458-33885480 AAACAGCCACACGAATGTGAGGG + Intergenic
1007337405 6:41163361-41163383 TACCAGCCCCAACCATCTGGGGG - Intergenic
1010730236 6:79383017-79383039 ATACGGCCCCAAGCAGGGGGTGG - Intergenic
1015374055 6:132490362-132490384 AAACAGCTGCCAGCATGTGTTGG - Intronic
1019881392 7:3864600-3864622 AGACAGCCCCAAGGACGTGAGGG + Intronic
1019901201 7:4021977-4021999 AAACAGCCCCATGGAGCTGGGGG - Intronic
1023286899 7:38630379-38630401 GCACAGCCCAAAGCAGGTGGAGG - Intronic
1025758331 7:64367137-64367159 CAACAGCCCCAGGCATATGCGGG - Intergenic
1031889199 7:127274513-127274535 AAAGAGACCCATGGATGTGGTGG - Intergenic
1034199700 7:149276295-149276317 AAACAGCCCCAAGCATCACAAGG - Intronic
1035183087 7:157105002-157105024 AGACAGCCCCAGGCAGGTGCTGG + Intergenic
1035494758 7:159314624-159314646 GAACAGTTCCAAGAATGTGGAGG - Intergenic
1036056634 8:5262258-5262280 AAACAGCCACAGGACTGTGGTGG - Intergenic
1041704006 8:60825991-60826013 AAATAGCCCAAAGATTGTGGGGG - Intronic
1041915872 8:63138177-63138199 AAAAAGCCCCTAGCATTTTGTGG - Intergenic
1042004841 8:64169085-64169107 AGACACCCCCAAGCCTGTGAGGG - Intergenic
1042876588 8:73446044-73446066 AAATATCCCTAAGCATGTGGTGG + Intronic
1043608255 8:82029103-82029125 CAACAGCCCAAAGCTGGTGGGGG - Intergenic
1044751145 8:95416776-95416798 AAACACACCAAAACATGTGGAGG - Intergenic
1044753238 8:95436350-95436372 GGACACCCCCAAGCTTGTGGGGG + Intergenic
1046612700 8:116443639-116443661 AAACTGCCTGAAGGATGTGGTGG + Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1048356599 8:133658974-133658996 AAACAGCCCCAAGCACCGGAGGG - Intergenic
1048883444 8:138888854-138888876 GAACAGCTCCTAGCATGTAGTGG + Intronic
1049094481 8:140540366-140540388 AAGCGGCCCCAGGCATGTTGGGG - Intronic
1052015661 9:23462903-23462925 AAATAGCATCAAGCATGTGAGGG + Intergenic
1054900043 9:70359429-70359451 AATCACCCCTAAGGATGTGGGGG + Intergenic
1058795179 9:108490821-108490843 GAACAGCACCAAGAATGTGGTGG - Intergenic
1060249407 9:121972906-121972928 AGACTTCCCCAAGCAAGTGGTGG - Intronic
1060296278 9:122345382-122345404 AAACAGCTACAAGAATGTGTGGG + Intergenic
1060468528 9:123929525-123929547 AAACATGCCCAAACATGGGGAGG + Intronic
1060821581 9:126664393-126664415 AGACAGCCCCAGGGATGGGGGGG + Intronic
1062208803 9:135351994-135352016 ATACAGAACCAAGAATGTGGTGG - Intergenic
1188257096 X:27976473-27976495 ATTCAGTCCAAAGCATGTGGGGG + Intergenic
1192202739 X:69077333-69077355 AAACAGCTCCAAGAAGGAGGTGG - Intergenic
1193746625 X:85289779-85289801 AAACAACCCCTAGCAAGAGGTGG + Intronic
1196935500 X:120726556-120726578 GAAAAGCTCCAAGCAAGTGGAGG - Intergenic
1198038791 X:132828166-132828188 AAACAGCCAGGAGCATTTGGGGG + Intronic
1200056481 X:153464011-153464033 GAACAGCGCCTCGCATGTGGTGG + Intronic
1200871542 Y:8104612-8104634 AAACAGCCCCAGGCACATGTAGG + Intergenic
1200889225 Y:8305262-8305284 AAACAGCCCCAGGCACATGTAGG - Intergenic
1201368545 Y:13235232-13235254 AGACACCTCCAAGCCTGTGGGGG + Intergenic
1202244483 Y:22804898-22804920 AAACAGCCCCAGGCACATGTGGG - Intergenic
1202397472 Y:24438644-24438666 AAACAGCCCCAGGCACATGTGGG - Intergenic
1202473309 Y:25231443-25231465 AAACAGCCCCAGGCACATGTGGG + Intergenic